Description :
From Genome Similarity Track
Location :
contig_6:159417- 166225
Transcript NameFunction/comments
g2074.t1hypothetical protein
g2075.t1hypothetical protein

Sequence
6808 bases(100 bases per row)
GAAAGCTGAACTGGGGATGCCGCGCACGTTGCTGAGAGCCTGAGCTTCGTACCAATAGCTTAGACCGATATCATAAAATCGCTCTGCGGCGACAGCGTCA
GGACCACCCACTGTCTTTTTTTCGCCCCTTTCAGCTAGTAAAGCAGCAGCTTCGTAAGCCTTCCTCCCAGCGCTGATAAAATCAACCCAGCTTGAGCCTT
CGCTTGAAAAGTTGTCTGGCGACAAGTAGAAAGCGAAGCAGTGAATATCACCGATTAGCTTGCACGCTTCCACAGACCCAGAGAGGGCTGACGTGGACGG
AAGTCCCTTCATCATTCGGGACGCCTCCTTCAGATTCGCAGCAGCATTGCCATATAATCCCTCAGCACATAAGTATTTTGCCTGTTGGAAAAGCAGGTCG
GCATAGATCATGGATGCGACAGTCACGTCTGGCTTGCCATCGGATAATTCACCAGTGACAACCGGTTTGATTCTATCCAACGCATCGTCGAAAAGCAGCA
ATGAGCCTTCAATCCGAGCCAGCTCACAACGAACGCACCAGTTTTCCTCACCCAGCTCGATGGCTTTCAAATAAGATCTCTGCGCGGAAACGTGCTTGTC
GAAGTTCTGGTAGATATGTGCCAGAATAACCCAATAACGGGCATTCATAGGGTCATTACGCAGCACGAGATGCATTTTTCCCACTGCCAATTCGTCGTTT
TGTTCCACCAGGTGCTGAGCCAGTCTCAGGAGCGCCCATGTCGGAGCAGTTTCTTGGTCCTCAGTCACTCGTTCCCATAGTTCCACGTTCGCGCCATACT
TTCCCTGTAGATCGTACAGGCTGCTTAGAGCCATTCCTGCCAACTCATCGGTGGGAGAAAGCGAAAGTGCCTTCAAGAAACACTTTTCGGCACGCAAAAT
ATCCTTTGCGACTTCTTGGTACCATTTACCCAGCCATGAGAAGATCTCCGCGTCGGATGGCGTCAGTTTCGCGGCTTGTAGTAGATGGGCAAAGCACCCT
GGTTTTGCACTTTGATGAGAACCGCCTAGGTGCCAGTACACAACTGCTAATCGCTTCAGCGTTCGCCCCTTAGCGAAAACATCAGTGGCTGGAATCTTGC
TCGCATTTGCCTCTAGCAGCGCTTGGGCTTGTTGGAAGTCGCCAAGTTGGAATTGAATCCACCCACGGGTGCACAGCACAGCAGCACACACGCTTTCGTC
CCCCACTTCAGACAAAGAAACGGAGTCAATGACTTCGAGAGCCTCCTTTGACTGCGCCTTGGTAGTCAATAGCTCTGCCGCTGCGATGGCCGCTTTTACC
ATGAGAAGAAGGTCGTCACTTCCCATGACTCCGCGGTAGTTCTCTAACGCTCTATCCACGTCACCCGAGTACTCGCACGCCGTTGCCGCCATGAACAGCA
CCTTGACTTCCGAATACCTGTACCATTTCAAATAGACCAGAGTCATTGTACGTCAAAGGCAACAATGGTAGGCGTTGATAACTTACAGAGATGGAAGCGG
GTCTTCACACCCAAGCAATTTCGCCTTGTCAGTCACAACCTTTTTGGCCAAGGACAGACGATTCAAGCAACCCTCTACATCGCGGGCTGCAAGTGCCAGT
GATGCCAACTCGACTTGAGCACGAATGCAAAGAGAGCTTTCTTGAAAAGAAGAGGAGGAGTAACCAGCGAGGGCTTCCACAAAGATCTCTCGGGCCTAGT
AATCCAAACGCATGTCAGAACTTACTGTTAACAGCAATGCCGATAGAGTCAACCACTTGCCTGGTTACTCTTTCCGAGGCGCAAGTACTCCACCGCTTGA
AACACAAGAGCCATAGGACTCCTGGAATGGCTTGCAAATAGCCCAGCCGCGACTTCCCTCGCCTTATCCAAAGTAATAGCTACCCGTTTTCAAACACCAT
CAGCAACAATGCATCAGCTCCGCCAACAATTAGCAAAGTCGACAGACAATGGTACGCATGGAACACGTACGACTATCCTGGTCTTCACTGCGGAGTAATA
GGAACTCTGCCGGAATCTTGGAACCAGGAAACCACTCGATGATTGTCGTCGCCAATGCATCGACCGTCTTGAGGAGCGTGGGCTTCTTTTTGGAAGCCTT
CAGTGCATCCAGGTGAAAGCGCATAAAGAATGCGATTGCGGCATCCATTCGTGGACGGAGCGCATCAATCTCTTCATTCTGAGCTGTCCAATCAGTACGA
GATGCAACGGCGAACACGTGACGAGAGATTTCTGGCATGGAGTAGCTGCCAGAGCAGTCCGATAAGCTGAACCCAGGACGCTGTACCAAGAACCTTCAAT
ATCCACGCCAGACAGCATAGCAACAACAACAAAATACATACCTGCAGCAAATCCACCAAATCCAGCCAGATATTCAGCGGGGCCGGTAATTCTTCGTTCG
CAGTTTTCTCGAGCGAAAGCTGTCCAACATCTCCATCCAGTCCCCCCACAAGGGAGTACCACGAGTCAAAGGTCTACATCAAAGCACAAAAAATGAGTAT
ACACTATCTTATTAACGTAGCCATAAAGCTACTCCACCTTCGGGAGCATCTTCAACTCCATTGCAGTAGCCGCCACCTCCGCTACCCACTTCTGGCACCT
CTTGATCTTCTTGCCCCTGCAAATACAACAGGTATCAGTCTACAAAAGGTCCACCCAGGTCTCCTCAGTTTGCAGTACCTCAAATTGATGTCCACGAGCT
TCTCCAGTGGCTCCAACTTGCTCTTCACATCCGTTTTGGCCTCGAAAAGGTCCACAAGGTACTGCAAAACCGCAGCAGAGAATCAGTCTCCAGTCTGCAA
CCTAAAGTAACCCTCACCACGCTCTGCACCTTCCAGGGCGCCGGCATCTCGGGCTTGATATCTGCCGCTCGGCGATACGCGTCCTCGCAGTCCTCCCACT
GGCAGCAAAGTATGGTTAGTATGGGTTACACATTGGGGTACAGTATCCTGCAGACGCACCTCTTGCAGGTGGAAGCTGGCGAGCCCCACACACATGAAGG
CCTGGAAGTTGTTGGGGTCAAATTGCGTCACGCGGCGGCCTGCGTCCTGCGCCTCCTGGTAGCGCTCGGCCTTGAGGAAGGCCGCGGCGTCCACTAGCAT
CTGCCGGAGCATGCTCGCCGACATGATGCTTCAATGGTTATGCTGGTTTTGAGGTAACCTACATTCTGAGGATGGTTACGAGTAACCTTCGTATTTTAGG
TAATCTTACAAACACTCATCCGCCAATTCACCCAGAACCATGTGGAAGACCGGAGTACGGGTTGTGACGCCTCTGCGGCGCTCGCTCACGTCTCCGCTGC
GCGGGCAACTACCGAGTGGGCGTCCGCGGTCACTGCAGGTGCTGTACGTGGCGCGCCCCTTCTCCACGTCCTCGCCGCCCCCAAGTACGTGACTTTTATT
GCGTAGATTGAAGTGCCCAATCTAATGCGGAATTGGGTCTTTTCACTCGCTCTGGGTTTTATAGCCACGCAGAATGTGCAAATGGCGACGGCGGCACTGG
TTGCAGCCGGTGTGGGCTATCTGTGGGTGACGAATGACCGCCAAAGCGAGCAGCAGCGCGAGCTGGAGATCCAGAAGGAGCGCAAGCTCAGCAACCGTCT
GGCGGCCGAGCTCGTGGCGGCCGAGGCCAGCCAGAACAAACTGGACTGGAAGGGTACGCTGGAGCGTGTCGTACCAGCTATCGTGTCGCTCAAGCTCAAT
TCACCTAAGGTGAATGATTTTTTTTTATTGTGCTGACATCATCAATGTTGACTGGGTGATTGCGTCTGGGTTGTTTTAGTTCTTCGACACGGAGTCGCCG
GGCAACGGGTCGGCCACAGGCTTCGTCGTGGATGCCGAGAAAGGGATTATTCTGACAAATCGTCACGTCGTGGGACCGGGGCCCATTGTACGCGAAGATG
TTTTTGGGTAAAAGGGGAATAATTGTTGATGAGATGTTTTTGTGGGTTTTATTAGGACGCCGAAGCGGTTTTCCAGAACAACGAGGAAGTGCGCGTGATC
CCCATCTACCGTGATCCCGTGCATGACTTTGGCTTCTTCCAGTTCGATCCGGCGGTAATTTTGCTTTCGGTTGAAAGGGTGATGTTGGAGATATTTAAGT
ATTTTTTCTTATGGCGATCAACAGGATGTGAAGCACATGTCGGTGCCGTCGCTGCATCTGCATCCGGACAAGGCCACTGTTGGAACGGATATTCGTGTGG
TGGGAAACGACGCAGCCGAAAAGCTTGCCATTGCTAGTGGCACGCTGGCGCGTCTTGATCGTGACGCTCCCAACTATGGCTTCAACAACTACAACGACTT
CAACACGTTTTACTACCAAGCTTCGTCAGGTACGGTTTCAAGGAAGGTTTTGTATCGCTCCGCTTGGGCTAGTTGCTTATCATTGCTTCTGGGTGGCAAT
GCTGCTATTGCAGGAACGACGGGGGGATCGTCGGGCTCTCCTGTGCTCAACCACGATGGCGATGCTATTGCTCTTAATGCTGGCGGCAAAATTGGCACGT
CTGCTTCGTTCTACCTACCTCTTGATCGTGTAAAGAGAGCGTTTGATTTAGTTCGAGAAGGTAAGGACGTGCCTCGCGGCACAATCCAAACAATTTTCAA
CTACAAGCCTTTCGACGAGGTGCGCCGACTTGGCGTAGACCCCGCCACGGAACGGCTCGTTCGCTCGACTTTTCCGTTGGAGACAGGCATGCTGACAGTG
GCAGAAACTATCCCGGGTGGCCCCTCAAACAAGAAGCTGCAGCCTGGCGATTTTTGGTTCGCGTCAATGGAGAGCTGATTACACGATTTGTGCCGCTGGA
GGCTATTCTCGACGACAACGTTGGCGATGAGGTAAACGTGCCTATTGAGTTCTTGCTACGCTTTTCCCCCGCAACGTAACATTGCTGACACGTGGATGGC
AACATGTTTCGTAGATCGAGCTTCAGATTGAGCGATCTGGAGAACTGGTGACGCACAAGATGCAGGTGCAAGACCTGCACGCTGTCACCCCATCCCGCTT
TATCGAAATCGGTGGGCAGTAATCAACCCACTGTCATACCAACAAGCTCGGAATCATGCCATGAGCCCTGGAGCTCCGTATGTTGCAGATCCGGGCTACT
TCCTGCAGCGCTCACGGATTGGTCGTGGTGCAATTATCCACTCGGTGAATGGCGTGAAGACACCTGACCTAGAGACGCTTAAAAACTACCTAAAGCAGTG
CAAGGACCGGGAACGCGTCGTAGTGAAATTCTCAAAACTGACGGACAAATCGGAGAAAGTCGAGGTCGTGCATGTAGACCGCAGGTGGTTCCCATTCTGC
GAGTACGTGCGCGACGACAAGCTTGGTACATGGCATTGCGAGCGCTTTGCGCCACCCAGCAACGCGAATGATGATAAGACGGACAACTCAAGTGCCGATA
AGCCTGTCGGCTCGACGACAACGCTGCCGGGCAAGAACCCAGTTGAGAACAAGCTAGCGCGATCGTTGGTAACAGTTGACTTTGACCGACCGTTCAGCGT
GAACAGTTTGTCAACGTCGAACTACCGCGGTACAGGACTTGTTATCGACGCTGAGAAGGGACTTGTGGTGGTGGATCGCAACACTGTGACAGACTCGATG
GGCGATGCTATGGTGACTTTCGCCAGCACCATCATCGTCCCAGCCCACGTCGTGTTTGTCCATCCGGTACATAACTTCGCCATCGTACAATACGACCCGA
AGCTCATTGGGTCGACACCCATTGAAAGCTGTCAAGTGGCATCTACGCCATTGGTGCCGTCTGATCCAGTGTGGCTCGTTGGTCTTATGAGCAGCGTGGG
GCGTAGTGGCCATTCCGACCTTGTTTCCCGCGAGACTATTGTGTCTGGCGTTAAGTGGATTGGCTTGCCCATGCCGAACCCACCGCGCTACCAAGAACAC
AACCTGGAAATGGTTTCGTTGCAGGACGTCGTTGGCACCGAAGGTGGCGTTGTATGCAGTGATGAGGGTGAAGTGAGTGCCTTTTGGGCTTCTTTCTCGT
TCCAACAGCAACGCCGTAGCTCGAAGGTGGAGAGTCAATTCAATCGCGGCATTCCGATGGATTTGATCATGGAAAGCGCGGCGCCGCTTATGCGTGGGTG
ACGCCAAAAATTTACGACCTCGGTGTTGATTTTGAGCACTTGAGCCTGGCCAAGGCTCGAGAGCTTGGACTTGGCCAAGCACTAGCCGAGATTTTGGAAA
AGGATGCGCCTGATCGCCGAACCATCTTGAGCGTAGCACGACGGTGGGGTGGAACCGAGGCACAGGATGTGCTCAAAAACGGCGACATCTTGGTTGCTGT
GGATGGCAAAATCGTGACAAGTTTTCGCGAGGTTGAGCGCTGCACACAGAAACCGGAGGTGCAGCTCACGATCGTGCGCGATGGCCGCGAGATGCAACTG
GACGTAAGGACCCTTTTCATGGAGCGCACGGAGATCAACCGCATCGTGTTCTGGCAGGGTTTACTCCTACAAGCGCCACCGCTATCCGTGTCAGCGCACG
CAGTATCTCGTTGGACGACGGTATCTACGTGTCCTGCCGATACTCGGGCTCACCGGCTGCGCGCTACGGCCCGCCGCCCACAAGTCGTATCAAGGAGATC
GATGGTATCAAAATCACGAGCATTGACGACTTCTTGCGCGTTGTCACTGCGAAGTCTGATAACGATTCGGTGCGTATCAAGTACACGGACCTCAGCGGCA
AGGATCGTTTAAGTACGCTTAAGCTCGAGCCAAAGTACTGGCTCACCAGCGAGCTGGTGCACGAGGGAGGTGAATGGCGTCGTGTCCAGCACTGAAATGG
CTATATCT