Description :
From Genome Similarity Track
Location :
Scaffold_421:1594- 2892
Transcript NameFunction/comments
g11097.t1hypothetical protein

Sequence
1298 bases(100 bases per row)
AAGGTGGACACCAAGGGATCACGCGGACGTATGAGAAGCTTCGTTCTGAATTCTACTGGTCCGGTATGTATGCCGATGTCGAGAAATTCGTCAAGGAATG
TGTAGATTGCGCCAGCAGTAAGGGGCGTCCTCCAAATCCTGGAACTTCGCCTGGAAACATTGAGCCCAGACGACCGTTCGAGGTTGTGTCCATGGATTTC
GTGACGCACATGCCTAAGTCGGACCGCAGAAACACCTTTTTGCTTCTATTCCAGGACATGTTTTCAGGGTTCGTGAAGTGTAACCCATGAGTTCTACGAC
GGCCCAAGATGTCGCTGAAGTCTATGAAGAATGCGTATTCAGGAGGTTTGGAGCGAGTTCTATGATAAGACATGACCAGGATCCAAGATTCATGAGTGAG
GTCTTCACGCGATTCTGAGAACTCCTGGGTAGCAAACAGCGAGCCACTCTGGCGTATCGTCCTCAAGCCAACGGCCAGCAGGAGAGATCTGTGCAGATTG
TGGTGCAAAGCATTCACGCGTACGTTGCGGAAGCCGACCAGAGTGACTGGGATGACCACGCAGAGCGACTGATGTTCGCTCTCAATTCGTCACTCGATGC
AACGAGACTGGATACCCCCTTCTTCCTGGTGCACGGCTGGGACGCACACGGTACGGTGTCTGCTATGCTAGGACCCAAGCCGTCGAGCGTCCAGGAACGC
ACTGCGTATGACTGGCGTCGGAAGTTGCAGCGGATTACAGCCACGCTTAGGCTTGTGCCAAAGACCTGCAAAAGAAGGCTAAACGCACGTGTTCTGCTGA
GCAGACCAGGAAGTGGAAGGAACTGTCCGAACGTTTGAGAGCTGGCTTCGCTGTGGGCGATGCTGTCTGGTTGTATATACCGAAGGTGCAGCCCGGACTC
AGCTGGAAACTAGCTCACATGTGGCATGGTCCATTCCGTACCCAGGAAATATACGACGACTTCAGAGTGAAATTCAGGATTGGGAACGCAGGATATCGTG
TTAATCCCTGGGTGCATGTGAGTCGACTAAAACCAAGAGCACTGTTCCCAAAGCGACCTGCTGTGGAAATTGACGTGGAGGAAGATGACGACTTCGACGC
AGCTTTGCTATCAGAAGACAGCTGGGAACCTGACGTCGAGAATGACGAGTACGAAGTCGAGCGAGTCCTAGATTTACGCTGGACTAAGAGGACTCGGACA
TCATAGCGCTCTCGCGAATACCTTGTGAAATGGAAGGGCTACGATGAAACGGAATGGTTACCTGTGTCGAGGCTTAACTGTGGTGCTCTATTATACGA