Description :
From Genome Similarity Track
Location :
Scaffold_326:15935- 18445
Sequence
2510 bases(100 bases per row)
AGGGAGGTAACGGTCGTGGGACCCCGTTACACCCTCCGTCCTTCTTAACCTCCGACAGGGGTGTACGTTATAGAATTGGCCTGGTTCCTGGAACCAAATA
TTGCGCTAAACTGTAATGGCCTTTACTAAAGAACACTGCGATGTTATCGATGAATTCTTTCGTGCAGAGCGCGCGGCAGGCATACTTCGCGAAAGTGAAT
TCCCTCACTCTACGACCATCTTCTGTGTGAGGAAGCCAAATGGTACGTGGCGCATTGTACACGCTTAGAAAAAATCAATGCCGCTACAATTTCAGCGCAA
ACATCGCTAATAAAACGGATGTTCTCCGAAATATATGGTTGGTTGCACGATGTAAACTGCACTTGACCTGGTCGATGGTTATCAACGATTACTCATGCGA
GCGAGCTATATTCCACCCACAGCGGTTATAAACCCGAGTGGTATGCTTTGGGAGCTGCTAATTATACATCAGAGGATATATAATTCCCTGGCGACTTTTA
ATCGTCCTGTGGCACATTTGTTCCGTTCTCACCGATGTTATGCACATACTTATTTTGATGACTTCTTATCCGTAGTCGAGCAGAAAACGGGAAGGCAGAT
GTGGAAAATCACATCGACCACTTGCGAGCAGTGCTCGAGTGCATGAGCATTAATAAGCTATGTGCCGATCCATCGAAATGCGTATTTGGTGCTATAGAGA
TAACCTTTCTGGGATGCTCCATACGATAGCGTGGACTAAGGGCTGAATCTGTACATGTTAAGGCCATATTTGATTGGCCGGTCCCTCAGAACCGGAAGGA
CTTGCGTTGATGGCTTGGCCTTGCAAATCCCTGCACAAATGTAGTGCAAATTACGCTAATATGGAAAAGCCATTGTCCAATCTCCTGAAAAAGGATACAG
AATGGTTCCAGAGTAGCGTTGAATATGAGGCTTTTACTGCCGTAAAAAAGATTCTCTTTTATGCATCGATTTTGGCCCTGCCTGATCCGGCGAGGCATTT
TTACTGTCGTCTGTGACGCATACGACTTTGCTATTGGCAGCTCTCTGTCACAAACATATGAGGAAGGACGTGAGTGTGTCATCTCCTTTGAGTCTGGCCA
GCTTAAAAGCAGCTGAAAAGAACTATCCATTTCATGAAAATAAGTTATTAGCTATGAAGTATTTTCTCTAGTCAATTTTAGCGTACATCTGCTGGGCTCG
AAGCCATTTGTGATCTTTATTGATCATGCGTCACTACGCACTGCCACACAGTCCCCCTCACCTCTCACAGAAATTAGACCGTTGGTTGTCATTGTTTGTG
GAATACAACTTCGGGGTGAAATACAAGCCTGGAAAACAGAACGCTTTGGCAGATGCGGTATCACGCATACCTGGATATGTGCTTGCTTATGTTACAACAT
TGTCGTCCTACAATTTCCGACTTGACTCGTGTAGCTTATGCCCTTGATGATCACTATAAAGCTTTGCTATGTGCTCTCGGAAGCGAGGAGTTTGAAGACT
CGGGCTAGAAATTGTCGGCACGATTGCGTGCGCGCCTCCACCGATATAGTCTCAGTCCGAGTCTCTTGTGCTATCGCATAGATAATGAGGATAGTCCTCG
CATTGTGGATTCACGTGATGAGGAGTTACAGTATCTCATTCTTTACTAGGCACGTAAACGACGATAAGCGGTCATTTTGGTCTTGATACGACCTATCACT
TATTGAGTCAGAGTTAATGGTATCCCATATATATATATATGCGGAGGGTTTGACCCGTTGGCACATGCTGCTGCACCACTAGCGAGTCTACCTGTCCCCA
AAGGGTATTGAGAGTCCATGAGCATGGATTGTGGTTTGGCCGTACAAAATATTCGGATGGCAGCACAAATATTGTCGCATGTGTTGACCGCTTAAGCGAG
ATGGCTCAGTTAGAGGATGTACCAGAAGCAATTGGCGATAAAGTTACAGCTCAGATGTTTATCGATTGCGTGTTTCGCCAACATGGATTGCCTCGAGAAA
TTGTTTCTGACCGCGATCACGTTTCACGGGACAATTTTGGAAGTCCATCTTCCAGGATTTTGGTACTCGTTTGTACATGTCCGCCGCCGATCATCCGCTG
AATAATGGTCAAATCGAACGCGTTAATCGCGTTGTGGAATATATTCTACGTAGCATATGTGCCGACGCACCACGGCATTGGGGCTCGATACCCCCTGTTG
TTGAGTTTTCTCTCAATAACGCTGCGCAAGACTCTACGGGCTAAATACCATTTTACTTCAGCGTCCTCACGCACCGCGCGTACCGTTTAATCTCCCACAC
GGTACGCTTGGGCTTGGTGAGGCAGAACTTGCAGACCGGCTTGCTAATGTCAGCAACATTTCTATTCAGAATCAGGTGCGTGCGATCATGACTACGCGCT
TTAGTGTTTTTAAGACATGTGCAGGGCGCAATGACTGAAAGTCAAGGTAAATAAAAGTAACAAGCGGACGCTAAAAGAAGAGGATGTACTAAAATTTTAG
AGGTCGGTGA