Description :
From Genome Similarity Track
Location :
scaffold_6:159340- 166152
Transcript NameFunction/comments
g1909.t1hypothetical protein
g1910.t1hypothetical protein

Sequence
6812 bases(100 bases per row)
GAAAGCTGAACTGGGGATGCCGCGCACGTTGCTGAGAGCCTGAGCTTCGTACCAATAGCTTAGACCGATATCATAAAATCGCTCTGCGGCGACAGCGTCA
GGACCACCCACTGTCTTTTTTTCGCCCCTTTCAGCTAGTAAAGCAGCAGCTTCGTAAGCCTTCCTCCCAGCGCTGATAAAATCAACCCAGCTTGAGCCTT
CGCTTGAAAAGTTGTCTGGCGACAAGTAGAAAGCGAAGCAGTGAATATCACCGATTAGCTTGCACGCTTCCACAGACCCAGAGAGGGCTGACGTGGACGG
AAGTCCCTTCATCATTCGGGACGCCTCCTTCAGATTCGCAGCAGCATTGCCATATAATCCCTCAGCACATAAGTATTTTGCCTGTTGGAAAAGCAGGTCG
GCATAGATCATGGATGCGACAGTCACGTCTGGCTTGCCATCGGATAATTCACCAGTGACAACCGGTTTGATTCTATCCAACGCATCGTCGAAAAGCAGCA
ATGAGCCTTCAATCCGAGCCAGCTCACAACGAACGCACCAGTTTTCCTCACCCAGCTCGATGGCTTTCAAATAAGACCTCTGCGCGGAAACGTGCTTGTC
GAAGTTCTGGTAGATATGTGCCAGAATAACCCAATAACGGGCATTCATAGGGTCATTACGCAGCACGAGATGCATTTTTCCCACTGCCAATTCGTCGTTT
TGTTCCACCAGGTGCTGAGCCAGTCTCAGGAGCGCCCATGTCGGAGCAGTTTCTTGGTCCTCAGTCACTCGTTCCCATAGTTCCACGTTCGCGCCATACT
TTCCCTGTAGATCGTACAGGCTGCTTAGAGCCATTCCTGCCAACTCATCGGTGGGAGAAAGCGAAAGTGCCTTCAAGAAACACTTTTCGGCACGCAAAAT
ATCCTTTGCGACTTCTTGGTACCATTTACCCAGCCATGAGAAGATCTCCGCGTCGGATGGCGTCAGTTTCGCGGCTTGTAGTAGATGGGCAAAGCACCCT
GGTTTTGCACTTTGATGAGAACCGCCTAGGTGCCAGTACACAACTGCTAATCGCTTCAGCGTTCGCCCCTTAGCGAAAACATCAGTGGCTGGAATCTTGC
TCGCATTTGCCTCTAGCAGCGCTTGGGCTTGTTGGAAGTCGCCAAGTTGGAATTGAATCCACCCACGGGTGCACAGCACAGCAGCACACACGCTTTCGTC
CCCCACTTCAGACAAAGAAACGGAGTCAATGACTTCGAGAGCCTCCTTTGACTGCGCCTTGGTAGTCAATAGCTCTGCCGCTGCGATGGCCGCTTTTACC
ATGAGAAGAAGGTCGTCACTTCCCATGACTCCGCGGTAGTTCTCTAACGCTCTATCCACGTCACCCGAGTACTCGCACGCCGTTGCCGCCATGAACAGCA
CCTTGACTTCCGAATACCTGTACCATTTCAAATAGACCAGAGTCATTGTACGTCAAAGGCAACAATGGTAGGCGTTGATAACTTACAGAGATGGAAGCGG
GTCTTCACACCCAAGCAATTTCGCCTTGTCAGTCACAACCTTTTTGGCCAAGGACAGACGATTCAAGCAACCCTCTACATCGCGGGCTGCAAGTGCCAGT
GATGCCAACTCGACTTGAGCACGAATGCAAAGAGAGCTTTCTTGAAAAGAAGAGGAGGAGTAACCAGCGAGGGCTTCCACAAAGATCTCTCGGGCCTAGT
AATCCAAACGCATGTCAGAACTTACTGTTAACAGCAATGCCGATAGAGTCAACCACTTGCCTGGTTACTCTTTCCGAGGCGCAAGTACTCCACCGCTTGA
AACACAAGAGCCATAGGACTCCTGGAATGGCTTGCAAATAGCCCAGCCGCGACTTCCCTCGCCTTATCCAAAGTAATAGCTACCCGTTTTCAAACACCAT
CAGCAACAATGCATCAGCTCCGCCAACAATTAGCAAAGTCGACAGACAATGGTACGCATGGAACACGTACGACTATCCTGGTCTTCACTGCGGAGTAATA
GGAACTCTGCCGGAATCTTGGAACCAGGAAACCACTCGATGATTGTCGTCGCCAATGCATCGACCGTCTTGAGGAGCGTGGGCTTCTTTTTGGAAGCCTT
CAGTGCATCCAGGTGAAAGCGCATAAAGAACGCGATTGCGGCATCCATTCGTGGACGGAGCGCATCAATCTCTTCATTCTGAGCTGTCCAATCAGTACGA
GATGCAACGGCGAACACGTGACGAGAGATTTCTGGCATGGAGTAGCTGCCAGAGCAGTCCGATAAGCTGAACCCAGGACGCTGTATCAAGAACCTTCAAT
ATCCACGCCAGACAGCATAGCAACAACAACAAAATACATACCTGCAGCAAATCCACCAAATCCAGCCAGATATTCAGCGGGGCCGGTAATTCTTCGTTCG
CAGTTTTCTCGAGCGAAAGCTGTCCAACATCTCCATCCAGTCCCCCCACAAGGGAGTACCACGAGTCAAAGGTCTACATCAAAGCACAAAAAATGAGTAT
ACACTATCTTATTAACGTAGCCATAAAGCTACTCCACCTTCGGGAGCATCTTCAACTCCATTGCAGTAGCCGCCACCTCCGCTACCCACTTCTGGCACCT
CTTGATCTTCTTGCCCCTGCAAATACAACAGGTATCAGTCTACAAAAGGTCCACCCAGGTCTCCTCAGTTTGCAGTACCTCAAATTGATGTCCACGAGCT
TCTCCAGTGGCTCCAACTTGCTCTTCACATCCGTTTTGGCCTCGAAAAGGTCCACAAGGTACTGCAAAACCGCAGCAGAGAATCAGTCTCCAGTCTGCAA
CCTAAAGTAACCCTCACCACGCTCTGCACCTTCCAGGGCGCCGGCATCTCGGGCTTGATATCTGCCGCTCGGCGATACGCGTCCTCGCAGTCCTCCCACT
GGCAGCAAAGTATGGTTAGTATGGGTTACACATTGGGGTACAGTATCCTGCAGACGCACCTCTTGCAGGTGGAAGCTGGCGAGCCCCACACACATGAAGG
CCTGGAAGTTGTTGGGGTCAAATTGCGTCACGCGGCGGCCTGCGTCCTGCGCCTCCTGGTAGCGCTCGGCCTTGAGGAAGGCCGCGGCGTCCACTAGCAT
CTGCCGGAGCATGCTCGCCGACATGATGCTTCAATGGTTATGCTGGTTTTGAGGTAACCTACATTCTGAGGATGGTTACGAGTAACCTTCGTATTTTAGG
TAATCTTACAAACACTCATCCGCCAATTCACCCAGAACCATGTGGAAGACCGGAGTACGGGTTGTGACGCCTCTGCGGCGCTCGCTCACGTCTCCGCTGC
GCGGGCAACTACCGAGTGGGCGTCCGCGGTCACTGCAGGTGCTGTACGTGGCGCGCCCCTTCTCCACGTCCTCGCCGCCCCCAAGTACGTGACTTTTATT
GCGTAGATTGAAGTGCCCAATCTAATGCGGAATTGGGTCTTTTCACTCGCTCTGGGTTTTATAGCCACGCAGAATGTGCAAATGGCGACGGCGGCACTGG
TTGCAGCCGGTGTGGGCTATCTGTGGGTGACGAATGACCGCCAAAGCGAGCAGCAGCGCGAGCTGGAGATCCAGAAGGAGCGCAAGCTCAGCAACCGTCT
GGCGGCCGAGCTCGTGGCGGCCGAGGCCAGCCAGAACAAACTGGACTGGAAGGGTACGCTGGAGCGTGTCGTACCAGCTATCGTGTCGCTCAAGCTCAAT
TCACCTAAGGTGAATGATTTTTTTTTATTGTGCTGACATCATCAATGTTGACTGGGTGATTGCGTCTGGGTTGTTTTAGTTCTTCGACACGGAGTCGCCG
GGCAACGGGTCGGCCACAGGCTTCGTCGTGGATGCCGAGAAAGGGATTATTCTGACAAATCGTCACGTCGTGGGACCGGGGCCCATTGTACGCGAAGATG
TTTTTGGGTAAAAGGGGAATAATTGTTGATGAGATGTTTTTGTGGGTTTTATTAGGACGCCGAAGCGGTTTTCCAGAACAACGAGGAAGTGCGCGTGATC
CCCATCTACCGTGATCCCGTGCATGACTTTGGCTTCTTCCAGTTCGATCCGGCGGTAATTTTGCTTTCGGTTGAAAGGGTGATGTTGGAGATATTTAAGT
ATTTTTTCTTATGGCGATCAACAGGATGTGAAGCACATGTCGGTGCCGTCGCTGCATCTGCATCCGGACAAGGCCACTGTTGGAACGGATATTCGTGTGG
TGGGAAACGACGCAGCCGAAAAGCTTGCCATTGCTAGTGGCACGCTGGCGCGTCTTGATCGTGACGCTCCCAACTACGGCTTCAACAACTACAACGACTT
CAACACGTTTTACTACCAAGCTTCGTCAGGTACGGTTTCAAGGAAGGTTTTGTATCGCTCCGCTTGGGCTAGTTGCTTATCATTGCTTCTGGGTGGCAAT
GCTGCTATTGCAGGAACGACGGGGGGATCGTCGGGCTCTCCTGTGCTCAACCACGATGGCGATGCTATTGCTCTTAATGCTGGCGGCAAAATTGGCACGT
CTGCTTCGTTCTACCTACCTCTTGATCGTGTAAAGAGAGCGTTTGATTTAGTTCGAGAAGGTAAGGACGTGCCTCGCGGCACAATCCAAACAATTTTCAA
CTACAAGCCTTTCGACGAGGTGCGCCGACTTGGCGTAGACCCCGCCACGGAACGGCTCGTTCGCTCGACTTTTCCGTTGGAGACAGGCATGCTGACAGTG
GCAGAAACTATCCCGGGTGGCCCCTCAAACAAGAAGCTGCAGCCTGGCGATGTTTTGGTTCGCGTCAATGGAGAGCTGATTACACGATTTGTGCCGCTGG
AGGCTATTCTCGACGACAATGTTGGCGATGAGGTAAATGTGCCTATTGAGTTCTTGCTACGCTTTTCCCCCGCAACGTAACATTGCTGACACGTGGATGG
CAACATGTTTCGTAGATCGAGCTTCAGATTGAGCGATCTGGAGAACTGGTGACGCACAAGATGCAGGTGCAAGACCTGCACGCTGTCACCCCATCCCGCT
TTATCGAAATCGGTGGGGCAGTAATCAACCCACTGTCATACCAACAAGCTCGGAATCATGCCATGAGCCCTGGAGCTCCGTATGTTGCAGATCCGGGCTA
CTTCCTGCAGCGCTCACGGATTGGTCGTGGTGCAATTATCCACTCGGTGAATGGCGTGAAGACACCTGACCTAGAGACGCTTAAAAACTACCTAAAGCAG
TGCAAGGACCGGGAACGCGTCGTAGTGAAATTCTCAAAACTGACGGACAAATCGGAGAAAGTCGAGGTCGTGCATGTAGACCGCAGGTGGTTCCCATTCT
GCGAGTACGTGCGCGACGACAAGCTTGGTACATGGCATTGCGAGCGCTTTGCGCCACCCAGCAACGCGAATGATGATAAGACGGACAACTCAAGTGCCGA
TAAGCCAGTCGGCTCGACGACAACGCTGCCGGGCAAGAACCCAGTTGAGAACAAGCTAGCGCGATCGTTGGTAACAGTTGACTTTGACCGACCGTTCAGC
GTGAACAGTTTGTCAACGTCGAACTACCGCGGTACAGGACTTGTTATCGACGCTGAGAAGGGACTTGTGGTGGTGGATCGCAACACTGTGACAGACTCGA
TGGGCGATGCTATGGTGACTTTCGCCAGCACCATCATCGTCCCAGCCCACGTCGTGTTTGTCCATCCGGTACATAACTTCGCCATCGTACAATACGACCC
GAAGCTCATTGGGTCGACACCCATTGAAAGCTGTCAAGTGGCATCTACGCCATTGGTGCCGTCTGATCCAGTGTGGCTCGTTGGTCTTATGAGCAGCGTG
GGGCGTAGTGGCCATTCCGACCTTGTTTCCCGCGAGACTATTGTGTCTGGCGTTAAGTGGATTGGCTTGCCCATGCCGAACCCACCGCGCTACCAAGAAC
ACAACCTGGAAATGGTTTCGTTGCAGGACGTCGTTGGCACCGAAGGTGGCGTTGTATGCAGTGATGAGGGTGAAGTGAGTGCCTTTTGGGCTTCTTTCTC
GTTCCAACAGCAACGCCGTAGCTCGAAGGTGGAGAGTCAATTCAATCGCGGCATTCCGATGGATTTGATCATGGAAAGCGCGGCGCCGCTTATGCGTGGA
GTGACGCCAAAAATTTACGACCTCGGTGTTGATTTTGAGCACTTGAGCCTGGCCAAGGCTCGAGAGCTTGGACTTGGCCAAGCACTAGCCGAGATTTTGG
AAAAGGATGCGCCTGATCGCCGAACCATCTTGAGCGTAGCACGACGGTGGGGTGGAACCGAGGCACAGGATGTGCTCAAAAACGGCGACATCTTGGTTGC
TGTGGATGGCAAAATCGTGACAAGTTTTCGCGAGGTTGAGCGCTGCACACAGAAACCGGAGGTGCAGCTCACGATCGTGCGCGATGGCCGCGAGATGCAA
CTGGACGTAAGGACCCTTTTCATGGAGCGCACGGAGATCAACCGCATCGTGTTCTGGCAGGGTTTACTCCTACAAGCGCCACCGCTATCCGTGTCAGCGC
AACGCAGTATCTCGTTGGACGACGGTATCTACGTGTCCTGCCGATACTCGGGCTCACCGGCTGCGCGCTACGGCCCGCCGCCCACAAGTCGTATCAAGGA
GATCGATGGTATCAAAATCACGAGCATTGACGACTTCTTGCGCGTCGTCACTGCGAAGTCTGATAACGATTCGGTGCGTATCAAGTACACGGACCTCAGC
GGCAAGGATCGTTTAAGTACGCTTAAGCTCGAGCCAAAGTACTGGCTCACCAGCGAGCTGGTGCACGAGGGAGGTGAATGGCGTCGTGTCCAGCACTGAA
ATGGCTATATCT