Description :
From Genome Similarity Track
Location :
scaffold_48:159330- 161608
Transcript NameFunction/comments
Plaha_PHALS_0227160s ribosomal protein l21-1

Sequence
2278 bases(100 bases per row)
CATTCCGCCATTTTGTGCCCCTTCGCCACCTCCAAGGATGAACATGCCGATGGACGACGCATCGATGGAAAAATACGCCGATGTACGAATTTCATTGCGC
AAAAAAActatcaaatttgatgaatTCTATGCAGTTTCTGGACAATCTTGAAAAAACAGATCCGGAAGGCTACAGACATCTCATTGACACAATGCAAAAC
CAATTGCAAGCCGCAGAGGATCCGATAAATTCATCAGGAGTTGACGCTGACGGTGCACTCTTGGATATTCTCAAGAATGTGACTGAGGTACGGGGAGGTG
CTGCCAACATTGATTCGCCAGGTATGATGAGCTCATTATCGCTATTCAGACCTATTTGATAAATTCTGGTGGCTTATCTTACAACAAAATTTAAGATTTC
AACCCGCGGTTTCCTGGTGATAAGGTAATGGGGAAAGACGGATTAAAGACGAGTTTAGAGGGGGTAAGTTTGGAATAAAGACAATTAAGAGGTCGAAACT
AAGGTCTAACTTTGAAACTTGGGTATTTTTCAGATGTACATAGAAGTCAAAGCTGGCTTTGTTATCAAGACAACTGACGTCAAATCCAGGAAAAAGGTGT
GAAGTCTAATTATATATCGACTGTGCAGTATCTTTAACTTGTGAGTGCACAGGTTTTCGTAAACGTAGTGTATGCTGATGAGATTCAAGAGTTTTCGGGT
AAAAAAAAGCTGGATGATGAGGGGAAGGAGCAAGAAGTAAGGCTATTCAACATTTAACTGCTAGCCAAATTCTGAACTGAGTAGGTGGGTCTTGTGTGAT
CAGGGAATTCATGTACCACTTAGTCTTGGCGCTCCACATGAAGTGAAAGATAAGAATGGAGTGGAATCGCTGGCTTTTGACGTTGCAGTGAACACGAAAG
TTGTAGACGATTGCCGAGCCGATAAATCCGGCGCATTTCGAAATTTTGTTTGCGAGCTTGCGATCGAATACATCGACCAGAAGGTACTTAGAATGTTTTT
GTTTCGGGTActtaatgccacatttgaCTGACACGCGGTATATGAGGCAGTACAAAATCAAGCTTGATGGTCGCTTTAAGCTGCCAAGACTGACGTATCG
TGGAGAGCTACCGCCTCCTAGGCACTATATACGCAAAACTCAGGCACCAATTATTCAGGAAGTTACTGCAGATAAGACGATTGGATCAAAAAATAGCAAG
GCAAAAGCTGCTTTATCAAAATCAGCGAAAACAGCTACAGCAAAATATGAGATTTATGAAGTATACAATGGAAATCGTTTGGTGTGTACAAGACTTCCTT
CTGTTTCAAAGGGCAGTACACCTTTGTCACAAGAGGTGTTGGAACAAGCGCAAAATCAATTAGTTGTCGTGATTCTGTTTCCGAACAAGATTTATACGGC
GAATGACATCCAACTAGAATTGCACGCCGAGCTATTGAGTATCAAGGCACCTACTCATCATGACTTGGGTATGCACAATGCATTTCAGTGAGTTCATTCT
GCGTCGAACTTATTGTGTATCTTCCAGACGTCTTTCTTCCGTATCCCGTAGATATTTCCTCTGCCAGCGTTTGCTTCAATCAGGATAATAACGCGCTGGA
GATGTCGCTTGTAGTCGATAAATCTTGGAACAGTATTGCATCCGACTGTGGTTCCGCGCCCTGGCTACTCGCAAGAGCGCTTCACGAGGACAATGAAGTT
GAAGATGGCAGCAATGTAGAAAAAGCTGCTGATCTTGTCGGCAAAAACCCAATGTCACTTGTGGAGAAATTTCATCTTGTGAATACAACGAAGTCGCATG
ATAAAGCAATTGGTGATAGACTCGCAACAAAAGCGACTCCACGATGGGATCCCGTTCTAGAAGATGAAGAGTTGCCTGAAGACCGATTTCATCGCAAAGA
TATGATGTCTATGCATATTCTCGAGCAGCGACGTGCTGAGCGTGAACAAAAGGCGAAAGAAGCTGATCAAAAACAGAGACAAAGGCGTGCAGAGGTTGAG
AGTATGCAAAGGAAGGCAGCAGAAGCTGGTAAAACATGGCGTGAGATGTATCCGAACGAGCCAGAAACAACTTACATAGATGTCGAGGAAATTGTCCGAC
AGGAAAAGGAAAGACTTGACCGTCATTtggaaaaaaagaaaatggaAGAGGAAGATCCATCCAGTGAGTTCATGCCTACAGAGGATGCAATTCGAGCAGC
TATGAAATGGTCTGAATCCAGAGCAAACAGAAATCTTGATTTGCAATCCGCCTTGGCATTCGATTTGCTCTAAAATAA