Description :
From Genome Similarity Track
Location :
Scaffold_50:15930- 18964
Sequence
3034 bases(100 bases per row)
TCACCGTCGGAAGAGGGTTCGTACTGACAGTACGGGCGGAGGCACCCCACGTAAAGCGTAGGATGCGTACGCATCCTACGCGGCAGCTCGATCGTGTATG
CGTTGCCTTGTCGGCGCAGCACACGAAAGGGGCCGATGTACTTGGGCAGTAGTTTACTGCTGCTCACGTTGGTCACTACGTGTCTAGGTATATTTGCCGT
AGATAGTAGGACTAATCGCCTTCAATAAACGAAAGAACATTTGATCGTCTATTCTGATCAGCGTTCCCTTTCTGCCGGTCCACCGCATGAGCGATGGAGC
CCTGCACGAAACGAACCACTGCTTCTCGAGCCAACAGAAATCCTTCTACTGACGAGACATTGTTTTGTTCAGTTCGCCTTGTGCGAACTGCAGAAAGAGT
TCTTTCCTCTTTCTGTTCGTCAGCGAGGGTGTCATCATCCTCGTTGGAATAGTCGTTGGCGATGCTGAAAATACCAGTATCGCCATCATCATCTAACTCA
ATAATAGCGTCATCGCTATTATTAGGATGATCTTATTCTCCGATGTCGACCTGATCGACATCGGCATCATACGTGACGACGTTAGCATCGACAAGTGATG
AGCAAGAGCCAGAACGGTTTTTGCTCGAGCGAGTCCCTCTCCCCTTAACCAAGAGTCACACTCTAATAGGGTGGGCAGACGCGGATGGTGTAAGTAATTC
AAGAAGAACGGTGTGTGCTGGGTTGACGCATGCACCGAATTATTGACGGCGAATTCCACCATGGGGAGTAATTTGCTCCAACTCGGGAACGAGTGGACGT
ATCCTCGAAGTGTCTCTTCGAGGTCACGGTTTGCACGTTCCGTATGACCATCGGTTTCGGGATGGTCAAATGTTGACATCTTCAATCGCGTTCCAAGTGA
TCGGAACACGGATTGCCAAAACTCCGCCGTGAACCGAGGGTCACGGTTGGACACGAGTTCACGGGGTAATCCGTCGAGTCGAAATATTGTGTCAATAAAG
ACACGAGCACATCCCTGTGCCGTGATCGACTCGGGTACAGCATCAAGATGCACCATCTTGCTGAACCGGTCTACGAGCACAAGAATATCATTATTCTTGT
GGTCATCGTCGGGGAAACCGAAGACGAAGTCGATGAAAACGGACTGCCAGCACTCTGCCGGGACAGGGAGAGGCTGTAAAGGTGCACGGGATAAAGGATT
AGGCTTCACTCGTTGACAAACCTTGCAAGAACGAATGTACTTGCGTACAAACTGATACTCGCGGGGCCAATAAAAGTCACGACTTACCGTAAGGTAAGTC
TTCTCCCTACCACGATGGCTACCTGTTGGGGCATCGTGACACTCATACAATATGCGCAAGCGCAAATTGTTATGAGCGGGTACGACGACACGAGGCGTGT
CGCCGGCAACGGCTGTATAGTACACCAACCCGTTGCGTGTTTTGTACCGATCTGATGAGGAACGGTACAAAGCCGATAAATCTTTCAACGATTTACAAGT
TCGATTCACCAGATGATCCATCAAGCGCAGAATATCCTTATCTTCTGCGTAGGCCATTCTTACTTCGTCAAGTAACGTTGAAGACGGGACACTGACTGTA
AGTATCGCAACAGTGGGATTCTCCTCACTGTTGGATGCCCGGCTCGAAATCGGGTCGCCGCGAAAGCGCGTCAGCGACGACATTCAGTCGTCCTGGTTTA
TACTCGACGAAAAATTTGTACGCCGCGAAGAAAGACAGCCCCCTCGCCATTCTTTGTAAGAGGTGCGAACTGTTTACGGTCGTGCGTAGTGACGCATGGT
CCGTAAAGACAACGAACGGTCTATCTCCCAAGAGATAGACACGAAAATAAGCCAGTGCGTATTTCATGGCAAGGAGTTTTTGTCATGCACTGGATAATCA
CGCTCAGCTGCTTGCAGCTGACGCGATTGATAGCAGATGACGTGCTCTGCTCCATCTGTATCAAATTGCATCAACGCACAGCCGATCGCAAAATCTCTGG
CGTCACAGACCAGGTGGAATGGTCTGTCCTGATCTGCAATCGCCAGAATGGGCGAATGCATCAAGCTCTGCTTGGTACGTTCAAAGTAACGCTGATAGTC
AGCGTTCCATGACCACTTCACATTTTTCATGAGTAAACAAGAAAGATGCATAGTCATCTCGGCGTAATTGCGCGAGTACTTGTGCAAGTATGCCGCTAGC
CCAAGGAACTTTCTTAGTCCCTTGACATCGACTGGCACAGGCCAGTAGGTGATCGTCTTGATCTTTTCGGGATCAGGGCGTACGCCGTGTTTACCCACGA
TGCACCCAAGAAGTGGTATTTCGCTAGCCGCGAATACACACTTCTTGAGGTTGGCATACAACTTATGCTTCCGCATAAGTCGAAGAACCTGACGAGCGTG
TGTTCTGTGAGTTTCCACGTCCGTCTTCCCATTCATAGCCCGACTATTGACGAACAAATCGTCAAAGCAACTCGGTGCGAAGTCCTGCACCGGTCTCAAC
AGATTTGTTATACATCTGTTGAACGTTGCAGGGGCGTTACTCAGCCCCTGTGGCATCACTAGCCACTCCCACAGTATACTTCTTGGGGTGCTCACCATCT
ATGATTAAGTCCTTCCTCGGTATCGGCATCTGAGCCGGTACCGTTTCAGCATTCAACTTCTTGAATGCGTGCACTATCCGCCACCCTCCTGTGGCCTATC
ACACACAGAAGGTCGAAGATCTGTGAGGGGAAGTTGATTCCCTCATATGGCCCGCTACGAAGCGACCGGCAAAGAACTTGTCGATCGCTAGTACTTGTTC
ACGAGGCAGTGGCCGCTGCTTCATGACACAGTACTTTGAGCCCAGTTTGAGCTCAATCTCGTGTCGAGTGCCTTTGTCCTTAGGCAACTCGCATGGAACG
GATTCAGGGAAAACATCCTTGAATTCGATCAAATCCTTATACAAAGGATTTCCTGAAGCGACTCCCAAGATTATGACGTGTATCGTTCAATCCGAGTCTT
CTCATCGAGGACACTTTCGTCCATCGATGAGCTG