Description :
From Genome Similarity Track
Location :
Scaffold_1302:1593- 2959
Sequence
1366 bases(100 bases per row)
GCAGCACCTCTTCGGACACGCATCGGATTTCTCGTTGGGCCACAAGCAGAGTCTCTGAGTCAGCACAAACAACGTTCTCTTCCTTCGGCTGATCCAGGTC
AAGACGTCAGAGAAGCAAGGCTTGTCTCTTCCTGGAACGAGCAGGGTTTGCGACGTGCCCAATCCATGCAATCGCAGTCAATCTTCTCATGCAAGCTGTT
CCGTGCGCTTTGTTTCTTTCCCAGCTTCCAATCTCGAATGCTGAAGCGGAGTCGTCGATCGTGACGTCAACTCTGCTAATTGAGTTGCTTGGGAGCGCTC
ATAGCGTCGAGACAGAGATCAGTCAGGACAAGATGCCAGTTTCCGCTACGACTCGAGCGCTAGATGGCCGCAGCTACGTCAATCGAGTGTTGAAGGAGAC
GACAAAGGCTGCTGGTGTAGAGAGAGACCTGGCGTTGCACTTTTTCAGGCGCGGAGGAGCCCAATATGCAAACGGAGACCCTAAACTGAGGGCGCAGTAG
ATTCTCGATTAAGGTGCTTGGAACTTAACGGCAATGAACAAGGCGTTTGCGTACGTCTTCAACACGACCAACGAAGACCACAAGATAGCCCGTGTGCTGA
GCGGTTGGAAGGGAAACGAGTACGTACATGTGTCAGAGCTGTCAGTTTCTGACACTCAAATTCTGGTGAAGATTGCTAGAGTTCAATCCCTGATGTTCAG
CGCTTGCAGCGACCTCAGCACACCAAGCTCCAACGTGAATCAGCGTGTTCTCGACCTCTGCGCAGCTCACTTGATCCGCTGCTATCCGCAGTTAAAGGAT
CTCAGCTCGAACGCGCCAGCTACCAAGCGGCTTGAGGAGTGCACCGTCGTAGCAGGATGCGAGATCGCAGAGCTGATGTTGTGGCCGCTGAAGTTGAAGG
AAGTCAAGCCTGTTGCAAACAGCAAACGCACACACAACACAAAACCTGACCAACAGACGATCGAGCAATACCAAGTGACGATTAAGTACCAAGCGGCTGT
CATTAGCGGACTTATCGAACTCAATCAGCGCTGGGAGCAAAGGATGGATGCCATCGAAGGAGAGCTAAAGAAGCGTCGCGCAGACTTCATTTCTACTACT
GAAGAATCAAGTAAAAACGAGAAAGCGTGTGAGATCGTACCCCCAAGAAGAAGAAATCGCCCACGACTCATCTCTGCTGTGTGGTTCGAATGGTGCGCTC
GCGAGCCTCGCTTGTGGTCTTCAAACGTCAGACGATAGTAAATTTCTAGCTTTTGTTAGACTGTGGCGTACATGCAGCTATTCCTGGACGATGGGTTTGA
CATTGTCGAAGGCGCAGAAGACTTCAAGAGACAGTGTTCGCGTACGGCGCTCGCGCTGAAGACAAA