Description :
From Genome Similarity Track
Location :
contig_15:159290- 161674
Transcript NameFunction/comments
g3366.t1timeless protein
g3367.t1hypothetical protein PHYSODRAFT_471625

Sequence
2384 bases(100 bases per row)
GGTCAGAAACCAAACGAGGTGGAAATACTGAAGTCGATCTGTCGAGATCAATTTTTGGCTCCCTCTGCGAAACTCGGTCTTCAATGACGTCGTGAGCTGG
AAATATGATTTGGCAACGATAGAGTCGCAGATCTCCTGCAGAACCTTCATCGTACGTCTGCGGTCACACAAGCGAATAAAGGTTAGTGCTCGCTCAGTTG
GTTCACGCACCCTTACGCGAGAACTTACTCATCGGATTCGGTCACCCTCCCTTTGCCGCCAAAAACCTCGTGAATATCGGTGACCGGGGCTGCACTCTTC
TTTCCTCTCCTCCGGGAGACCGGCTTCTTGGCTGCCTGTGGGACCTGGTCGTACACTGTTTTGGAGAAGTCCGACACCACTGTCGCCCGCCCAGTGGGGC
CGACCATCTTCATGATCCCACCGAAGTTGGAATGGCGATGTGATCCAGACTGGTGCAGAGCCGACGCCTTCTTCTCGCTGTCCAGCTTCGCAAGCAGATT
CCCACCTGCAGACGCAGCATTCCGAGCTCCTGACGGCGTGGTCGTCGCAGCTGCCTGTCCACTCGAGCTGCTCGACGTTTTCCCCGTCAGCTGGTTCTTC
GCGTATGCCACCACGCACTTGGGCTGGGAGCAGTCCAGCGTCAAGTCGATCATCTCCATGATGAGCAAGTTCCACTCCCTGTTCTCCGGCGCCTCGATAT
CCTGCGTAAACAGCAAGATCATCTCGTACACGTTCTCGTCGTGCAGCGTGCAGATAAAGTCCTCCTGCAAGTGGCTGAAGTAGGACGTGGTGGACGTGAC
GAACCGCGGGTCCTCGTTCGGGATCGCCAGCAGGTTGCGCAGCAGCGTGAGCACGATTTCCATGTTGAGAAAGTCCTGCGGCGTGCGCGCCGAGCCCTTG
CGGGACAGCGGCTCCACGAGGATCGTCATCATGATGGGGACCACGCCGCAGCGCAGGAACTCGTGCTTGTACTGCCTCAGGTACTTGAGTTGCTGGGCGA
TGTTGGTGGAGTCTCGTGGGGGCTTCGTCGTGAGCATCACGAGCACCTTGAGGATGGAAAACACGAGCTTCCAGTCGTGCTGGTGGTGCACGAGCAGCGG
CAGCAGCTTCTTCTGCAGGATCTTCCACTTGCCCAGCTGCTTGGTCACCAGTCGGTGCTTGGCGTGGTCGCGGCGCACGGCGCGCTGCAGGTCGTGCACC
CAATCGTCGCAGTTCTCGCCGCGCAGGAGCACAGGCGCCTCGCCCTCGGTCTGCACGCGCAGCATGCCCAGGTTGGAGCACACGAGCAGCAGCTCGTTCA
TCATGTCGGCGTCCAGCGCGGGATCGTTCCCGTCCTTGTCTTCGTCGGACGAGGACATGGCGAAGTCCTCCAGCTCCTCATCGCGCTGGACAGTGGCGTC
GGACGTGTCCGCCATTATTCCTAATGGCTCACTTTAGCTACTGGCGCCAAAAAGCGGCGCGAGAGTGATTGTCGTATACACTAAGTGCGATTGGAGTCCG
AGCCTCAGTTTAATCTTCACAGGATGGAAGCGCTCGCAGGACCGCTGCCTATGGAGCCGCAGGCGCAGGACGCACAGGATCAACCGATGCAGGACGCACA
GCCTCAGGACCAGACCGCGCAGGGCCAACAGCAGCAGAGCTTCGCGTCCTCCGGCTACGACAACGCGATGCAGTTCCAGCAGCAGTCACAGGCCCAGCCG
CAGCAGTTCCAGTCTCCGCCCCAGCAGTATCAGCAGCCCCAGCAGCAGTCCCAGCAGCAGCCCAGCAGCAGCCCCAGCAGCAAGCCATGTACAACTCGCA
GGCCCAGCAGATGAACGCCTACAACCTCAAGGCGCCGCCCGCATGGCGTTTGGTGCCTCGTCCGCCGCCGTGGAGGAGCGTGCCACGCACCTGCTGGCCG
CATGTGAGTCCTGCCTCGTAGTTACGCGCGTGCCGGGCGTGGACTTGTCGTTCCGCCGCATCATGGAGCGCAAGTGTCCGCGCTGCGGCGGCACGCTGGT
GCTTCCCCAGGAGGTCATGGAGATGCTCATCCTCTACGGCAACTTCGTGCCCGAGTCGGCGGCCGTCACGCTCGTGCTGGGCACCATGGTGCTGCACCCG
TCTCTGCGCGCGGACTTCATGGCGGCGGCGATGAACGAGCTGCTCATCCCGTTGCAGACGGACTTTGTCTATGATGTGGCGGTGCCCAAGCGCCCAGAAG
GACTGGGCATGTCGCTGCGCATGCACCGTGAGCGCCTTACCGAGTGATATGGGGGATTCCTGTGGATGATTTTGACGTTATGTGGCTGTGTGTTTTGTTT
GCAGAGGGAAACCTCGTGGTTGGCGGCTTCATCGATTTTGAGAACAACAGTGAGAGTCCGTCCGTGGCGGCTCGGATCATTGCC