Description :
From Genome Similarity Track
Location :
Scaffold_160:15928- 18060
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_160-abinit-gene-0.47SET domain containing 3 isoform a (predicted)
Pytve_DAOMBR484maker-pve_contig_160-fgenesh-gene-0.9Whole genome shotgun sequence assembly, scaffold_7

Sequence
2132 bases(100 bases per row)
GTGACCTACCAGCGATGAGCTCTAGTCCTGCGGTGGTGTCAGCGCTGCTGGCGTGGCTTGGAGCCAATGGCGCGCCGCCTTCGCCGCGGCTCGAGATCCG
CTACCTCGGCCAAGACGAAGGCCACGGCGTGTTCGCCGCCGAGCCGCTCGCCGCCGGTACAGATGCAACCCACAGCCACTGCATCCCAGTCGCTGTGTTC
ACGCGTTTTACTGTAATTTGAGCAGGCGATGTGACGATCCGCGTGCCGTTCAAGCTGACCATGTCGATCGAGTCGGCTGCCCAATCGGACTTGTCGCCGA
TCGTGCAGGCCTACAAGGACCTGCCGGCCGACGAGCTGCTGGCGCTGCACCTTATGCACGAGCGTAGCAAGGGCGACGCGTCGTTCTTCGCGCCTTTCAT
CCGGTCACTGCCGACGTCGTTCGAGCTGCCGGTGTTCTGGTCGGACGCGCAGCTCGGCGAGCTCGCTGGCACCAACGCGCTGCTGCTCACGCAGATGATG
CAGCGTCAGCTCGCGCAGGACTTTGACGCTATCCACGCGGCGCTGGTGAGCGAGTTCCCGATCATCTTTGGCAAGTTCCCGCCGCTCACCAAGCAGGACT
ACGAGTGGGCCATGAGCGTCATCTGGAGTCGCGCGTTCGGTGTCACGCGCGATGGCGCATACCTGCACGTGCTGTGTCCGGCGATGGACATGTTCAACCA
CGACGTGGCGCTGCGCAACCCGCTGGACGACTTTGTCAGCTACGACGCCGAGACTCAGGAGCTTCAGCACCGCGTCGCTGCCGACGCTGCGATCCGCACG
CCGCTGCACATCAGCTATGGCCAGTACTCGAACGCCAAGCTGCTCTACTCGTACGGGTTTGTCGTGCCAGGCAACCGAGTCAAGGGCATCGACCTGTGGA
TGAAGGTGCCAGCCTCGGACCCGTACAGCAAGCTCAAGCAGACCCTGCTCGACTCGCACGAGCTCACGCGCGAGCAGACGTACGACTTCAAGGGCACGCT
GTTCGGCCACGACGTCGACGAGCGGCTGCTAGCGACCCTGCGCATCATCCTCATGGACGAGCAAGAGATCCGAGACTACAAAAGGGTGAGACGGAAGATC
GGTCCGTTGCTTTGATATGACGACTGACCTGGTGGTGGATGGTTTTATAGGCGTTCGAACAGTCCATCCTGAGCGTGCGAAACGAGCTCGCCGTGTATGA
CAACCTGCAGCTCACGTTCCAGCGCAAGCTCGCCAACTTTGCGACCACGTGCGTGTGCATTGGACCTTCCACTCCTTGGCGTGCCGAACTACAATCTAAC
TGGAGGTGCAATCGTTTTGCAGCATCGAAGACGACCGCGCCATCCTACGGAGCGCGCAGCTTCAACGCGACATGCGGCTCGCGTTCGCGGTGCAAGTGCG
GCTGGAGGACAAAGAGGTGCTCGCAGGCACGATCGCCACGCTCGAGAAGTGGAAGGCAGCGCTGGCAGCCAACCCGTCGCAGTATCCTCCACGTTCGACG
CGCGATCGACCGGTCGACGTCAAGCAGTAGAGTGTCAGCACGTTCAAGAATGATGGGGAGTGTCAGCACGTTGCACTTCGTTATTATAAGGGTTGACAGC
GATACTCGACAAAATTGGCGACGACTCGAGACACCTTCGCAAGATGGAAGACCCCGAGCACGAAGCAAGCTCGTAGCCTACTGGGCGATCTTCTTGTCCA
GCAGCTGGCGCAGCACGCTTGGCGTGAACATGCCGATTCGAGCCTCGACCTCCTTGTCCGACAGGTACTTGGCGCCACCGATGTGGTGGCGGCAGTTGGG
AGCACCGCACAGGCAGTCAAACTTCTCGTCCATGTCCCATTCGCTTGTCGTGTAGTCGAACGACAGGTGCTCGCCTGGAGAATCGCAACAGTCGCCGAGT
TAGCCTCGTCACATTTTGGCCAGCACCACAGATGACCAAACTCGCACCTTCTTCGATGTCCCGGGTAGCAACAAACGCGATCTCCTCGGCAGTCTCCGAG
ACGAGGATCTTGGTGTTGGGAGCGCAGCTGTGGTTGACGAACTCGAGGCCGCCGTGGAACTCGAGGTGCTTGTCGGCCTCCAGCTGGATCGTCCAGCGGT
TCGGCGTCTTGAACTGCAGCGTCGACATCGCA