Description :
From Genome Similarity Track
Location :
Scaffold_407:15926- 18999
Transcript NameFunction/comments
Phypl_g7968hypothetical protein
Phypl_g7969unknown

Sequence
3073 bases(100 bases per row)
CCACTGGGTGAATGTGCCACCCAGACTGAACAACTCGACAGAAGTGTGCGAAGAAGTCTACGCGGTATCCGCGATAGGCAAGAGAGACGGTATTAAAATA
CCAGATCTTACCAACGGCCGCGCTCTTACCAAGAGTTAATGTATAAACTTAGTTGCTGCAACAATGTCCTTTCCGGTGCTCTATCTCTGCTGACGCAGAG
CAGCTAGCTCTGCCTGCTCCGTGATCTCgactggtgctggaggcaaGAGAAGTGATTCGTAGGATTTCGGGTTTTGAGTGAGCCCCTTTTTGAAACCCGG
TTTGCCAAAAGGActgaaaggcacaatacacGAACCTATATGtcatgtacttcgaagtagtgATTTACACACACTACTCTggataaaatccagagaGAAA
TATCTGCGTATATCCGTTGTTAAAATGAATAGCACTTCAACTACTGTCAGTTCGTCTCATGTTGCACTCGGCCAAGATGCGAACACGGTGGAGTCGAATA
CTGACCCCCAGCTCTTCGAGATCTCGGTCAGTCGCTTGGGCAAGTAGGGCGCCGTCAATACCCTGAGAGCGGAAGTTAGCGCCATAACTGCCATTGTCCA
GCCCCAGCGAGTCCAGGAAGGTTTGCACCTCGCGAACTCCCCACTGCTCCATATCTTCACCTCgaacttcaagctgctggttctgcaCCTGTTCAGACAA
TTTCGTCTGCTGTTGTCGATTTGGAGTGGACAGTCCCATGCCGCGCTTGTGCTCGTCTACTTCTGCTTTGGACAGCGACGCATTTACGCGCAGTACAAGA
TCGTTGCGGATCTGCTCGTCTTCCAGCAGTGCGGTCTCGAAGAGAGAGGAGTATACCCCCTCTTTGCGTTCACAGGGTGTCGGTTCTCTAGTAGGTGGTG
AGTGAGCTTGAGATCGGGCAAGACCTCGAGGATCGCCACCCGAACCACGACGGTCTTTCGTAGCGCGATAAATTGCCTCTTTGCGTTTGAGTTCGTTCTT
GCGCTGGTACAAGTCTCCTGATCGGAACTTGAGGTCGTTGACGAGATTACCGATCCGAGTCTGCAATCGGCGGCGTTTGTCTGGGAGAATTGCGTCTTCG
AGACGGGCTTGAAGAGCGGCAAGCTCGTCTCGCATCGCACCTATCTCGTGTTCTGCTTGGGTGATTAGCTCCCGACTAAGTGCAATATCCTCGCGCATAG
CAGCTTCTCGGGGATTACTTGAGGCTGGAGCGGTGCCAAGTAGGACAGCGCTGCTTTCATGAACAAAGTGAACTTTTGATCGTGttctttgctgctgctg
ctcagaTGATTCAAGCGGGCCTACGGCAGCAACGGAATCGCTGTCAGATTCGTGAACAGCCCTCACCGGATCAGGATTTTCAGGCGCTTGTCGTCCTAGT
CGAATCTGTCGACGTCGTGCTTCTGCCTCCCGTTCACGAAGTAGCAACTTCGACGCAGGAAATACGCGCCGCATGCTAACATCGCCGACCCAGTTGCCTA
ACAACTGGACCGCAGACTCTGGGACTTCTTCGCGAAGGGCTGGATGATCGAGGTGCATCAGAGCAAGGAAGGGGTTGTGCGTCAACCGTagcacctgcag
cgactcgagcagaGCCACGCCTCTGAAGGATGCCAGGAAGTCCAAGTCTGCCGTCATCTTGAGCAAGTAGTTCACGCCGCGCCATTTAAAGCTCGTAGCT
TGCACCTTGGACTTTTGTGTTTGCTGCCACTGGTCGATGTCCTCAACAATCTGCACGCTCACGGAACGAAGTTGATCAATGACGCTCTGGAAAACCATCG
GTGCTTTGGATATTCCAGAGATCCGAGCTTGTTGCGGCTTTTTCGCTGCtccaagcagctgctgcagcgcctcaaTACACCCTTCGCGCTCAACGATTCT
TCTCACAATGTCCAAATCGCAGGGCTTTTCGAACGAAGCACATGGAGGGAAAACGAGTGTGGTCGAAGCTGAGCCGCGGAGTACATTCGATCCGGGAGCT
AACGAGGTCATTGGATCAGGCTTATCCTACGCGAAGACGGGCCGATCGGGTGAATCAACTACGTCAGTGACTTACACAATAGCTTGTCAAACCTTTTCCA
GTGCAGGACGGAAATAGGTCTGCATATTTGCAGGTGCCGCAAAATAGCTGGTGAGTATGGATAAAAATGTTTGATACACGGACACCTGCGCAACATAACT
CAACAGGGTGCCACACATGGGTTTGCTTTATTTTCTTCATGTGTCAGACCGATCCACACCCGGTTCGCTACGTTAGCTAAAGCCTTGGTGCCGTCTCGTG
ACGACAGCTACCTGAACAAACATATCCCTTGTCATATGCTGTCTCTGCCCCTCGTGGCAGGTCAGAATCCCCATCTACTGTAAATGTCGGGTTAGTTCTT
GGTCGTGTCCGGGTCGAAGCTGTCCAAAGTGTACTCGCCAAGCTCGCCTTCCGTACTAGTCTGGTTGCTCGCCTTCTCAGCAATacgcgccgcctccttg
gtGTTCTGCTTCTGGATGTTTCCGAAAATGGAGAGCGCCGACGCGACCATGCTAGAAGGGTCGTTGGTATTGGCTGGTAGCAGCACAGTCGTGCCCTCCT
TAGCGATGTTGCCGAAGGCATCCACGTACTTCTCCGCCACCTGGAGAGCCACCGCGTCACGTCCACCCGTTTCCTGAATGGCGCCCGAAAGCCGCTGAAT
GGCTTGGGCAGAGGCGCTAGCCTTGGCTAGAAtggcagcggcggcacctTCTGCCTCCAGCACAGCCGCGCGCTTCTTACCCTCAGCCACGTTAATGTAC
GCCTGTCGTTCACCCTCCGAGTCGAGGATCTCGGCGCGTTTCCGacgctcggcctcggcctgcATGTCCATCGCCGCCTTGACGCTGCGAGGCGGGGCGA
TATCCCGGATCTCGTATCGCAGACACTTGATGCCCCAGGCCTCGGACGCCTGGTTGATGGACTCCACGATGCTGAGGTTGAGCGactcgcgctcctcgaa
gGTCTTGTCCAGCGTGATCTTGCCGAGCTCGGAGCGCATGGTggtctgcgccagctgcgtgACGGCGTAGAGC