Description :
From Genome Similarity Track
Location :
contig_15:159243- 161644
Transcript NameFunction/comments
g3990.t1hypothetical protein
g3991.t1OWZ16544.1 hypothetical protein PHMEG_0009645 [Phytophthora megakarya

Sequence
2401 bases(100 bases per row)
AAGATATGCCATCATCTCGGCCAAAAGCTGGACAGCAACCGTCATGCCGTGGTAATTTTTCATCGTGGCGTAGTTTTCGATCGACTGAAGCACAAAATTG
AAGGAGAACATGTCCAACGTAGACAGCACCGCCTTCTCATCGTAGTCAGGCTTTTCAGGTGCCGGTGGTGGGGGCGTGGTGAAATCCAACGCATTCTGAA
GCTCCGTTGTTTTCTTCTGCACTGCCTTCAGCTGATGTTTGTAGTGCGACTTGAGCGCTTGGATCTTCAAGCGGTGGTATGTGGTCAGAAACCAAACGAG
GTGGAAATACTGAAGTCGATCTGTCGAGATCAATTTTTGGCTCCCTCTGCGAAACTCGGTCTTCAATGACGTCGTGAGCTGGAAATATGATTTGGCAACG
ATAGAGTCGCAGATCTCCTGCAGAACCTTCATCGTACGTCTGCGGTCACACAAGCGAATAAAGGTTAGTGCTCGCTCAGTTGGTTCACGCACCCTTACGC
GAGAACTTACTCATCGGATTCGGTCACCCTCCCTTTGCCGCCAAAAACCTCGTGAATATCGGTGACCGGGGCTGCACTCTTCTTTCCTCTCCTCCGGGAG
ACCGGCTTCTTGGCTGCCTGTGGGACCTGGTCGTACACTGTTTTGGAGAAGTCCGACACCACTGTCGCCCGCCCAGTGGGGCCGACCATCTTCATGATCC
CACCGAAGTTGGAATGGCGATGTGATCCAGACTGGTGCAGAGCCGACGCCTTCTTCTCGCTGTCCAGCTTCGCAAGCAGATTCCCACCTGCAGACGCAGC
ATTCCGAGCTCCTGACGGCGTGGTCGTCGCAGCTGCCTGTCCACTCGAGCTGCTCGACGTTTTCCCCGTCAGCTGGTTCTTCGCGTATGCCACCACGCAC
TTGGGCTGGGAGCAGTCCAGCGTCAAGTCGATCATCTCCATGATGAGCAAGTTCCACTCCCTGTTCTCCGGCGCCTCGATATCCTGCGTAAACAGCAAGA
TCATCTCGTACACGTTCTCGTCGTGCAGCGTGCAGATAAAGTCCTCCTGCAAGTGGCTGAAGTAGGACGTGGTGGACGTGACGAACCGCGGGTCCTCGTT
CGGGATCGCCAGCAGGTTGCGCAGCAGCGTGAGCACGATTTCCATGTTGAGAAAGTCCTGCGGCGTGCGCGCCGAGCCCTTGCGGGACAGCGGCTCCACG
AGGATCGTCATCATGATGGGGACCACGCCGCAGCGCAGGAACTCGTGCTTGTACTGCCTCAGGTACTTGAGTTGCTGGGCGATGTTGGTGGAGTCTCGTG
GGGGCTTCGTCGTGAGCATCACGAGCACCTTGAGGATGGAAAACACGAGCTTCCAGTCGTGCTGGTGGTGCACGAGCAGCGGCAGCAGCTTCTTCTGCAG
GATCTTCCACTTGCCCAGCTGCTTGGTCACCAGTCGGTGCTTGGCGTGGTCGCGGCGCACGGCGCGCTGCAGGTCGTGCACCCAATCGTCGCAGTTCTCG
CCGCGCAGGAGCACAGGCGCCTCGCCCTCGGTCTGCACGCGCAGCATGCCCAGGTTGGAGCACACGAGCAGCAGCTCGTTCATCATGTCGGCGTCCAGCG
CGGGATCGTTCCCGTCCTTGTCCTCGTCGGACGAGGACATGGCGAAGTCCTCCAGCTCCTCATCGCGCTGGACAGTGGCGTCGGACGTGTCCGCCATTAT
TCCTAATGGCTCACTTTAGCTACTGGCGCCAAAAAGCGGCGCGAGAGTGATTGTCGTATACACTAAGTGCGATTGGAGTCCGAGCCTCAGTTTAATCTTC
ACAGGATGGAAGCGCTCGCAGGACCGCTGCCTATGGAGCCGCAGGCGCAGGACGCACAGGATCAACCGATGCAGGACGCACAGCCTCAGGACCAGACCGC
GCAGGGCCAACAGCAGCAGAGCTTCGCGTCCTCCGGCTACGACAACGCGATGCAGTTCCAGCAGCAGCCACAGGCCCAGCCGCAGCAGTTCCAGTCTCCG
CCCCAGCAGTATCAGCAGTCCCAGCAGCAGTCCCAGCAGCAGCCCCAGCAGCAGCCCCAGCAGCAAGCCATGTACAACTCGCAGGCCCAGCAGATGAACG
CCTACAACCTCAAGGCGCCGCCCGCATGGCGTTTGGTGCCTCGTCCGCCGCCGTGGAGGAGCGCGCCACGCACCTGCTGGCCGCATGTGAGTCCTGCCTC
GTAGTTACGCGCGTGCCGGGCGTGGACTTGTCGTTCCGCCGCATCATGGAGCGCAAGTGTCCGCGCTGCGGCGGCACGCTGGTGCTTCCCCAGGAGGTCA
TGGAGATGCTCATCCTCTACGGCAACTTCGTGCCCGAGTCGGCGGCCGTCACGCTCGTGCTGGGCACCATGGTGCTGCACCCGTCTCTGCGCGCGGACTT
C