Description :
From Genome Similarity Track
Location :
Scaffold_16:159242- 161703
Transcript NameFunction/comments
Phypa_INRA-310PPTG_08717calcineurin-like phosphoesterase

Sequence
2461 bases(100 bases per row)
ATGGGCGTTGATGGCTTCGCGATGCACGCGGGGCTCGGACATCGGGTGCTGGACGAAGAGGAATTCGAGAACAATTATTACGGTGAACAGAAGCTCATGG
AAGGCGCGCTCATTAAGCTGGGGGACTACGCGCACTATCGGTACTTCCAGCTCTTTCGCAGTGGACGCTTCTGCTACTACGAATTGCCCACACCGGCGGT
GACAGCCGAGGGAGTTCGAAGAGTTCACCTTACATCGAAACATCAACGTGGCATCATGATGCTCCACGCACCGACTCAGGTTAAAGACTTAACCAAGAAT
GAAGAAGAATACGAGGCCTATCTGTTTAAACGCGGGCTCGTGTTTAACCGCAAGAAGCTCGAGATGCAACTCACGGGATATTCGCCATCCGGTCAACTAT
TGTCCTGGAAAGTTCGAGCCAGCAGGGATACCGTGTATCTGAAGTGGGAGCGTGCCTTTCGCCTTGCACTTCGACCGATTTGGGTGCCAAACTCCAACCA
TTGCATGGTCTGTAAGAAGGACTTTACCTTCTTCACCCGCCCACATCACTGCCGGTACGTTATGCGGACGTTCATTACCACTATTCGTTCGACACTGACA
GACTGATATGTACATTGTAGTAAGTGCGGGACGTGTATGTGCGATGAATGTACAGTGTTCGCCCCGCGGTTACCATTGCAAGGCTACTACGATGAAGTGC
GTACCTGTAGAGACTGTTCCCCCATCAGCATTCCGTGCTCGTCGCTAAAACAGGGTACTCGAGTCCTTGTATACGGCATTTTGATCGGCCGTGTGGTGCA
AGTGAACGTTTCTGAAGGTACTGAAGGTAGGACGCTTGTAAATGTGGAGCTGGAGAAACAGAACAACGAGGTGCGGAGCTTTGTACTGCAGCATGTTCAG
CTATACTCAGACGCGGTGTTATCGGCGAACCGGATCAAGAACGCAATTCGACAGCATCTAGCGTACTCAGTGTTCCGAACTCGTCTCAATTTTAACACTT
GGAACATGTTGGAAGCGATGCAGGAGCAGCGGACAATGCAAATGATGCGGTTCGTAAAGAAGTCGATGAGTATTAGCGAACTACACTCCATGGTGCCATT
ACTCATCTCGCTAAATACTCTTGACGGGGTCGTTCTGGAAAGAGAGCGTGTTAAAGCTTCGCTCACTCATTACCGCGGAGTTCGTGTCCTGTTCCCTTTG
CGACTCATCACAGTGAAAAGGTTAATTAACCAGTTCCGCAATGGTATTTTATTACATCCTGTCTTCGTTCGGCGCATCCTGGACGAGGCGGGAAAGCTAT
TCCGAACACACCACGAGTCACCTATGAACTCGGTTGATATCCCTCCTGGAGTAAGAATGATTGTCGTCGGAGACCTTCACGGGCAATTAGAGGATTTGTT
AACAATTATGGAGAAGAACGGCATACCAAGCAACAAAACGTGGTATCTTTTCAACGGAGACTTTGTGGATCGTGGAGCGCACGGGGTAGAGATTATGTTG
TTGCTACTTGCGTTCAAGCTGTTGTATGCTGAATTCGTTTTTCTGAACCGTGGAAACCACGAAGAGCGTATGATTAACGAAGTGTTTGGGTTCCAAGCCG
AGGTTTATTCCAAGTACGGTAGTGGTTGGAGTGGTCTGGGGTCATCAGTCAACTACTCGGCATCGAAACTCTTCCAAATGTTCGAGACGGTCTTCGATTT
GTTTCCAGTGTTTGCGCTAGTAAATAAGTGTATCTTCGTTGTTCACGGTGGTTTGAGTAACCACAAGAATGTCACGATTGAGGAGCTACTCCAGCTAGAC
CACCGAGGTGAGCCGACGCAGGGAACGAGTCGTGCGGATGAGCTGCTGATGCATCTTTTGTGGAGTGATCCATGCGAAGAAGACGGATGGAAGCCTTCGA
GTCGAGGTGCTGGCGTGGAGTTTGGTCCTGATATCACCAAAGCGTTTTGCAAAAGGAACGGGGTTAGTCTCATTATCCGATCTCACGAGTGTCGAGAAGA
AGGGTTCGACATCGTTCATGACGGCCTTCTGTTGACCGTGTTTTCGGCCTCGAACTACTGTGGCTCTCAAACCAACAAGGGAGCCTATGTTCTTCTGGAA
CGTGGAGAAAGAAACGAGATACAGCCGCGCGTGGTGCAGTTTTCATCGCAACCGCTGCAACAACTGAAAGCTGCGGGGAGGAACGAATGGCGAGAAAAAG
CTCGGCGTTTGGAGCGGCAAACGGTGGAATCTCTCCAGCAGATTATCTGCGAGAATCAGTATGCACTTTTGGTCTCGTTCCAGCAGGCGGATGATACACG
CTGTGGGCGCATTTCGAAGATTTCTTGGAAGTCAATCATGCAAAGAGTTCTGGGGATCCATACAAAATTGCTCTCGTACTTCCGTCAACTAGGTGCAGAA
TCTGAAAAGGGTGGCGTCGATTATCTCACATTTCTCTCGAAAGCGCAGTATGCTGTCGAGT