Description :
From Genome Similarity Track
Location :
contig_34:159197- 160583
Transcript NameFunction/comments
g8151.t1hypothetical protein
g8152.t1hypothetical protein

Sequence
1386 bases(100 bases per row)
GCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTA
CTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGACGTCTGCGCCGGTTCCGTCGCATCGTTCAGTTTGTTGTAAGCAT
GAACGATGCGCCACCCGCACTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTC
AAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACA
CCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGC
CTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTC
GGACGTCCGAGAGGATGCATGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAGTTTACTTA
AGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGGG
TTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTAC
TTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATGCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAA
CCGAATGTGTAGCCCCGCTACACCATCCCCCCGTTAGGATTTGACGTGCCGGTCTCGACACGTCAATCCGTATTTTCTTCGGGAGAACACGTGCTCATTC
CCAATGAGCACGCCAACGACGTCTTCGTCCAAGACGCCGGCCGCTTCGGCAACAGCAAGTGCTGTCGTCGCCTCCAAGGCGACGACGGCCGCTGCCTCAG
CCACGACCGCTACTGGCATCGCCTCGACGGCGATGCCGACAAGCGCGGCAACAGAGAGTCGCCTCTCTGTTGCTGGATACCACTCGAGATGGCATGAGAA
ACATGCCATCCGAAACAAGACAGGCAAGATCATTGCTGTCGAAACCGGAGTGGGTATCTACTCTCCGGGTGGAGAGGGAGTTCCCC