Description :
From Genome Similarity Track
Location :
Scaffold_568:15919- 17883
Transcript NameFunction/comments
Phyta_totarag9327hypothetical protein

Sequence
1964 bases(100 bases per row)
GGCGTCGCACTCGTGGTGGACGATATCAGCAAAGGCTGCAACTTGGCGTTCCGATACCCTTCTCCGCCCTCCGAGAATGCGTCCAGCTTCCACAGGCTCC
CGGCCCCTCTACTTGCCAAACTCTTCCGACCCAAAAATGCTCTGTGCAACGCCAGcttcgagctcgtggtgGACGACCTGCGCTTCGTGAGCCACCCAGT
GTTGGTCTCTCGTCGACTTccggctgcagctccggcggACGGCCCGGGGAACGGTTCTACGTCGTTTAATGGGTCCACATCGGCTTCAGGGACATCCTCT
ACAGTTACAGAGCAATCTACGAATGGTTCTACCGTCACATCGGGGAACGAGACGACCATGTTCAACATCATTTTCGCACTGGAGGACCGTCTTCCACAAG
TGTCAAGAACGGTGGAGACCTTGGACGGGGTCATTGATACCCAATTGCTGCCTTTACAACAAGCAGATGAGGAGGAACTTCTcgccagaagaagaagcag
tgCTCAAGCTTTCCACACCGTGGCAGCGCAGCTGTCCAACGGCCTTTTGCACGAAGAACTTCGCGTTGGTTTCGTGTCGAAAGAAGTGCGAGAGTTGCTG
CAATTGAGAGATGAACTGGCGCAAAGTGAACGCAGTGCAGGGAATAACAATACGGGGATTCCAGGTGTTACCAGTGGATCCAGCGTgagtgctgcagttg
cagcaggtgcaaCGAGTGGCAGCAGTATTACGAGTAATGCTGGGGGAGGCGGCACTGGAACCAGTGGATCGAGTTTGATGCACCACCATCATCACAGGAA
GGACGGGGAGAATGGATCCACGACTTTGGATGTGGATCCGCAGACGCTGATTGACGTTTCGTTGGGCAAGAGTGTGCTGGCGAATGACCTAAAGAGAGTA
TTCCATGGACTGGAAGAATCTGGAGCCGCTCACGTGGTGCTGAATGGCTGGGTGAAATTGTCGCTGACCCTCACAGACGCTGTTACAGTGCGAATGGCAA
GTTTACGACCGTATCACACCCTTCTGCTACTGGCCGACAAGAGTGATATTCTAAATAAGCTGCCTGCAGATCATGCGCGACAACTCCGAGACCTGGTGGA
GGCTGTGAATCCGCTGAAGAGTTTCCAGGATATGGCCCTTGAGACGGGTGTGCCTATTCACCAAGTCTTTCGACTGTCAGCACATCTCGTCTATTGGGGA
TTCGGACGCATTGTGGACGCCATCACCCTGTACAACATATATCAGGTCAATGCGAAAGCAGATCTGCATATTACGTCATCGCTGGCACTGGAGTTCCGGC
GTAAATTCGCGCCTTACGAACTGGGAGAGGTGTTGTCAACGTTTTCGGGAACTCGTCGCATTGGCGAGTACATGAAGACCTTGTCTACGGCCAAGAAAAC
CGAGTACATTCACATGCTGATCtggctgcttcagcaacggtTTATTGTACAGCTTCACCGCTACATCTATTTTATGATTCCGTCGGATGGAGACTACGCC
GCTGAGCTTGGTAATGGAAGCACATCTTCGATTGGAAGTTCCTCTCCTGCTCTGATAGCATCCAGCTTTCGTCGACAACGAGTCAACAGTAGCACTACCA
ACACAAGTGCACCTGGAAGTTTGCCAATAGCTCGAACACCACCTATGAATCCAGCTAGCATGGCGTTACCGTCGCCTCCAACAGCACCGTTGGACGGGAA
TCCTGCAGCAGAAAGGCACGGAGGCAGCACAGTACCGATGGCGCAAGTGATGAGCGTGGCTAGCCAATTGCTATTCACAGACCAGGAGCGTGCGTACCTA
GCTAAGATTGCCAAGCCCAACCCAGTCTTTACGCTTTTCAAGCGGCTATGTGTATATTTCCACGGAGAGCACCATATCGAAGAGATCATGTGGCGCGAAA
ATCTTTCACGAGGTGAGCTTCGCACAGTCATGAGCACGTATCAGGACATTATCGTCTGCTGTCT