Description :
From Genome Similarity Track
Location :
Scaffold_14:159168- 164174
Transcript NameFunction/comments
Phyci_90918AlNc14C417G11489
Phyci_304023Hypothetical protein
Phyci_113314Hypothetical protein

Sequence
5006 bases(100 bases per row)
CGAAGCCCTCAAGTTCCTGGCTCTTTCGACGAGCGCACTCAATCACTGATGCAGGGAAACCCGCCATGGATGCTACGTGGACACCGAAACTCTCCATGCA
AGGCCCGTCGCGCACTTGGTACACCATCGTGATCTCGCGTTCGCTGGCCACTGCTGTGACGTGCTTGTTCGCAAAACCCAATGGGTGTTCCTGCTTCAAA
GCTGTCAACTCGTGGAAGTGCGTTGCAAAGAGGCACATGGAACGCGCGTTCGTGAGCAGATACTCCGAGATAGCCCAGGCCAGGCCAAAACCATCGTACG
TGGAGGTACCGCGGCCTAGTTCATCGATAATCACCAACGAACGCTCTGTGGCTTTGTGTAGAATGGCGGACGCCTCCAGCATTTCCAGCATGAAAGTTGA
AACACCCCGTTGCTGCAGGTCACCGGCACCAACACGCACCAACAGCTTGTCGAACACTGGCAACCGCGCGACTTCCGCAGGCACGAAGCTCCCGATCTGC
GCCATCACTGCAATGGTACCCAGCTGACGGATGTAGGTACTCTTGCCACCCATGTTAGGCCCCGTAACTAGCTGGAATCGTGACTTCTCCCGCTCAAAAC
TGTAGTCGTTTGGAATGAAGTCGACACTGTCTTGCAGCTCCACACATGGGTGGCGGGCGCTCGTGAGCACGATGCAGTCGCCGTTTTGCTCCAGAGTAGG
ACGACAGTAACCCGATCCAGCATGGCACGCCGCATGAGCGAAACCGAGTAGCACGTCCAGCTCTGCTAGAGTAGACGTTGCAGCTTCGAGAACAGGTACG
TACGTGCTGGCAACGTCGATTGCCGCACTCAGCAAGTGGGCTTGACGCTCCTCGTATTCGCCACGCACGCGACGGTAATCGGTGGCCAGAGCCTTTAACT
TAGTCGTCGTGAATTGCACGCCGCTCACTAGCACCTGGCAAATGTGCACGTACGGCAACTTGGACAACCGAGACTCCTCCTTCTTGTTCACAACACGGAA
CGCGAACCCGCGCACCTTGTCCTTCTCGCACTTGATCTCTCCGCCAATCGTGTCGAGTGCGTTGCGATGCTCCTCTTCAATGTCCGCGAGGATTCCATCC
CATTCTTCACGCAGCGCCTGCAGATCCTTATCGTGCTTAGCATTCACCACAAGCGTCGGGCGGCTATCCAGGTCGACAACCTCCGTCACAAGTTCCGTAT
ACCCTTGCAAGTCCGCGAGCACTTTCTCCAGCGGCGCCGCAAACTTCTCCTTCACCAGACTTGCCAGCGCTTCGTCTCCACCGGCCGTAGTCTCCTTCAA
TAGCTTCTGCACACGAGGCATGGCGCCAACGGCAGCGTCGTACACACTAACCAGATCCGTGATCTTCGCGTGCTTCTTGCGCTCCAGACTGACCGCCAGT
CGCCCCAAGTCCGGCAGCGCCTTCATGCACTCGTCCAGCAGCTCCATCCTCAGCGAGGAATCGTCCACAAAGAGCTGTACGAGGCTCTGCCTCGTCTCGA
TCTGCTTGACGTCCAGCAGAGGCTGACGGATCCAGCGCTCCAGCAGGCGGCGGCCCATGGGCGTCTTGCCTCGGTTCAAGATCTCCAGCACGCTGCCGCC
GAACCTCGTCGCGCCGGCGGTCGCAGCGCTCGGCTCCGGCAGCAGGTTGAGCGACCAGACGGCGGCGCTGTCGAGCTGCATGGCCGACGAGAGGTTGCCC
TCCTGCAGCGTGTAGCAGCCGAAGGCGTCGGCGTCGGCCATGACGCCCAGCGCGTTGATGAGGCAGGCCAGACTCCCGGCCGCCAGCTTGTTCGCCAGCG
CGTCCTGGTACTCGGCCATGGCGCTGGCGCCCAGCAGCCTGGCCACGTTGGTCTCGACGCCGCTGACGTCCTGGAACAGCTGCTTCTTCATGTAGACGCG
CGCCACGTCGAGCGTCTGCAGCAGCGCGTGCAGCTTCTTGCTGTCCCCCACGGCCTGCGACTGCTCCAGCTCCGCCGACAGGTAGCACGTGGCGGGCGCC
AGCTGCACCAGCAGCGACTCCAGGTTGGCCAGCTCGCTCGAGTCCGAGAAGCGGAAGAGCAGCAGCTCCCACTGCTTGGTGTCCTCGCCGGCGCGGCCCT
TGACGCACGACGCGCGCGCGCGCGGACGGCGCACGGCCACCTGCTTCAGGTGCTTCTCGTTGCGGATCTGCAGCGCCACCTCCGCCTGCGCCTCCTCCAG
CGCCTCGGGCGCCGAGTCGTCGTCTGAGCGCTCGCGGTCGGCCATGCTTTTCACTGCTCTGCTGTGCTCTGTGCGCGGCAAATTCAAGAGTGATGGTCGT
CTGAGCGCGCCAAAAGTGCGCACGCAGTTCCCGCGCTTTCCGATGTCCGGATGGATATGTCTCGTTTCGACGGTTGATCATACAAACGGCAAGTGAAATG
AAGTTCGACCCTCTTTACCCCGGACACTTTCGAATTTGCAGCAATGGCCACGGACTGGAGGGCGGAGTACGCGAAGGCGGCGGCGCTGCAGGAGACCGAC
GACGTCTCCGAGGCTGCCTCCTCCGTGCAGCAGCCGCAGAAGACCCCGGAGGACGGCGTGCTGGCGTTCGTGGACCTGCTGCTCGCCCAGGAGGGCGGCG
AGTGGTGGGTCAAGCTCCAGCGGCAGGCTAAGCGTGCCGCCAAGCAGAGTGATGGTCACGAGGTTGAACTGCGGCCCGACGAGGACAAGAAGCGGCTCAG
GGCGATGAAGAAGCGGCTGGCGGCTGTGGCCAAGGAGCTGCAGTTGGAGCTGTCGGCGCTGAACGCCTCCGTGAGCAGCAAAGACGCGCCGCGCGCAGCC
AAAGTGCGCGTGCTGCAGCTGCAGCTCGTGTTGCGCATGCTGAGCTACGGCACGCTGGCCAGGAAGAAGAAGGAGCAGAGGAAGATGCTGAAGAAGGAGA
TCCGAGGCCTGCTGGACCGCGTGGCATTGCTGCTGGACGCGGCCAACCCGCCGTCGCTGGCGGACGAAGACGCGGACGAGCGCTCGCCGTTCCAGGAGTT
CCTGCAGGAGCAACTGGCCCCCAGACTGAAGATGCTGCTGCCGGAGCTGGTGCAGTATTTGCTGAGAGCCTACGAGCTGGAGGAGGAGGAGGACGCCAAT
GATGAGCCGGAGAACGAGGCTACTACCGCCATGCTGCCTCCGGTGAGTGGATGCGTGGTCTTTGGTTGAGTGCTGCGATGTGTTTACTGATGGTGTTGAG
CCGGTTATGGTGTCGTGCAGTTGTTGCCAACAGTCAAGCCACCGCAGCCCCCTGACGAGTTGCCGACGTCTGCGGCTACGGGCAAAGGGAGCATCTTGTC
GGCTTTGCGTCAAGAACGACCTGCAAAGCGCACTCTCCAAGATGCAACTGGGCTGTTCAAGGAGGTGCAGCTACCTCAGCAATTGCAGCGACAGCAATTG
CAGCGACAGCAATCGCAATCACGACCGCGGAAGTCGAGACGGGTGTCTAAAAACCATAGCAGCGCAACCAAAAGCCGCAGCGACAAGAAAAGCAGCAGCG
ACAAAAGTGGTCAGGATTCGCTGCTTCGCGCGGCAGCAGCTGGGACTAAGTCGACACACAACCCGAGGACACTAGATTTCGCGGGCATGACAGCCCTCGA
AAAGGCACGCATTGCGTCAAGCGCGCGGAAGCCTGGCGATTCCGAAGTGCTGCGTCGCGCCGCCATAACTTCCAGCGCTAAGGGACCTACAGCCCCTCTA
CTCCACCGTGCCACGTCGGAGCGCTCCCACTTCAACGGACACCAAGCAGCAGGAGGAATAAGGTCGTCGCCGGGTGCTGCTGTTCACGCTACAGGAACAA
CTGCAGCAGGCAGTAACCAGTCTCCACCATTGCGTCGTGCAGCGACCACTTCGTCAGTGGTCATGCGTACGCCAGATAGACCGCAGCGATCAGCTGCACG
AACTACTAGGAGGGTCTTGGTGGAAGCATCACCTCCTCTCCGTCGGCCGAGCGGAACTGCAGTCACTGCGCCTCGACTTCTTCAGCCCAAGTCCTCACGA
AGAGGATCCACCCCTCCTCCCCTGTTCCGGTGAGGCATGTTCAAAGCAAAACTAATAGACAACCAAAACTAATCAATTCTACGTTGCCACTCATTCCACT
AGCTGTCGCTGTCACTGTCACTGCCATACGCCACCAATCCAAGTGCCGCAGTATTCGGCTTCTCCTTTTTCTCCACAGGAGTCTCACTCGAGGCCTTTGC
AACAATCTTTTGCTTCTTCTTCACCGACTCCTCCTTCGACATATCGGACGACTCTACACTCTTTGGGGCAGCTTTACGAGGCTCCTCCTTATCAGCCTTT
CGCTTGGCGCGCACCACCACCACCGGAGCCTTCTTCTTGCTCGCAGTCTTGCTATCGTCCTTCGCTGGATACTTCTGCAATTGCTGAGGCGTAAGTGCTG
CACCAGCAGCAGTTTTCGGGGCTCCTCGTGCCACCACTACATACACATCCACAGAACGCATCAGCTACCAGTCCAATGCTGTCGCCAGGAAAATAGGGCC
GTCTTCCGTCCTCACAGAATTGGGCGAGGTCCTCCTCGTGCTGTGCTTGGCGCTTCCGCTCCGAGTCCTCCTTCCTGCTCTCCAGGTCCTTAATGTACTC
GAACTCCTCCTCGTCCAGTCCTTTCGGAGGGGCTATTGGTAAGAACCAGAGTGAGTGAATAGCTTGTCGTCAATGGCACCCCCTCCCAGCCCCCGCAGTC
TATGCCCACCGAACGGGTTGTTCTTCTCCTTCCACTCGCTGTCCTTCTGCTCCCGGCGCTCCTGCAGCTGTTCGTACAGCGGCTTGTAGCCTGCCGCGTC
CTCTGCTCGCGGGGCGGGCGCCTCTGTCACGCGCTTCTCCTCCACGTTGTCACCGAAGAGCTGCGAGCCACAGACCACGGGTTGCAGCGTCAATGCGGGT
TATTCCGGCGAGTTGCCAGCAACGAAGGAGGTTATGGCGCACCCCATCGGAGGAAGTGAGCACAGACGTGGAGACGAAGCCCGCCAGAGACGCCCTCGGC
ACGCCG