Description :
From Genome Similarity Track
Location :
Scaffold_67:159148- 163604
Transcript NameFunction/comments
Aphas_H257_14598PREDICTED: uncharacterized protein LOC578974
Aphas_H257_14599Hypothetical protein
Aphas_H257_14600Hypothetical protein

Sequence
4456 bases(100 bases per row)
GCCCTGCCCGACGACGACGTGGGGGCGTTCAAGCCGAGGGACCAACAACGGTCGTCGCCCAATGGCCCGTTGTCTCAAAACCGAGGTATTGTCATCACGA
CCACCTCAGGATTACGACATGCACAACGACATATGTACATAGACATCATGTCAGTGCGCAACTGGTTGAAACAGTTGGAATTGGGCGAATACACCGAGTC
GTTTGAAAAGGACGGCTTCGACACGCTCCGCGGCGTGGCCACCATCGACGAAGGCGATCTCATTGAAATGAATGTCAAAAAAGGTGCAATCTATCTATAT
ATATATATTCTCAACACTTGAAAATGAATGTCAACAAAGGTCTAATCTATATATATATATATATATATTCTCAACACTCGAATATCGGTATGTAGGCCAC
CGACGAGGGATTTTGCAGCACATTGAAGACCTCAAGAACCAACTGGCGGCATTCGATGACCAGGCCCAGCTGTCGGGGGTCGAGCCGGACGCATTGCCGA
CGCTGAGCATGCTGCCCCAACTGGTCAAGACACCGAGCGCCACCCAACTCCAAGCGCTCATGAACCAATCCGCTTCGATCAACATTCCCCCTCCGTCTGT
CTCGTCTGGCCCGATGGATTACACGAATTCCAACTAGTTTGTCATATATCGAGTAGTAACTACTATTAGTATTACTACGTATGAATTATAAGTGTTAGCG
AGTGGATTTGTCTGCAAAGGGACTGCACCCGGCCATGGTGCAGTAGTTTTCTGCGAATTCCGTCACGTCGGTACTAATCCCACATAGCAAGTGAATAATC
GTCCGAGTTGAACGAGACTTTGGAGTAAGAATAATGTACCTGCCACGACCCCGGTACCACCGCTTGCTCACGGCGCCTCGGCCGTTCTTCCACGCTTGGT
CGTGGGCCCAACTAACAGTTAATGAGTGACGATATATTTCACTGCATCTTCTAGGTAGAAAGGACGTACCCGACTTTCTGCGCTTCGGTCATGGGCACGG
CCGAGATTTCCTGGGGCTTTTTCACGTTTTGCTTGACCTTTTCCGCCACTTCGTTCGAGGTCGAGCCGACGGGGTCCGTCCGGCTAAAGTCCGATGGCTT
CATCATTGTCGGCTTTGGGGTCACGGAACTCACTAATGCCAGTCGGTGTGTCATCGGCGACAGGTTGGTAGTATGTAGTAGTAGTACATGTTTTGGGGTT
GAACTGGAATGGTGTGGATGGACCTTCCATGAGCAGCTCCTTCTTGAGATGCTCGCGCCATATCTGGTTCTTGGACACTTCGTCGCATTTGACCACGACC
CCCGCCGCCTTCTTGTCTGCCATGGATCGCGTTGTGCTCGGAAACAATGGCTATTGTTGTTGCTCATTTGGTATCAGTATTCTATTTTTAGATTTTATCA
TTTTATCCAATCCAAATCAAGTAAAGATCGGATATAAGGCCAGTAATATCACGCATGCGTGCAACATCTTGCCCTGGCGTGTGTATCGACCGTAATGTGC
CGGACTTGTATGTCTTCGTAGGGAGAGATAGGTACTGTATCGGCGGAGGTAGGTAAGTCCAGTACCATTAGAACCGGTTGAAAGAAAACCAATGCCATCA
CTTGCTCGGTTGGTGGTCCTATTAATAGTACAGTACTATGTAGTAATACTACAGTAGTACTACAGTACTAGTGGTCCACTGCCAATCACCTTATATTCTC
AGGAGTACAAGTACTTCAACTGGAACACGTTATTTGTAGTAACGTTACTAGTACGTTTGAACATTACTACGTAGTACTACTGTTAACCCTATAGGACGTG
AAGTCAAACGCAAGTCAAGTATACATAAGAATAGACTTGATTATAGTATGGTTTCGTTCAGGTGAGAGATTCTATCACCCAGAACTTCAAGTTACTCGAG
TAAGAGGTACTAGTACTGTGATCAGAAACGGCGTAGTTTTAATCACTTGTAGTCCAGGTGATAAATTCTATCATCTGGGATAAGCCAATCAAACGTCAGG
CATCTCTTGTTTAATCCAATGTCGAAAGTATATTGGCTGATATATAGTCGTACTTTCATGAGTTCTTATTAACCGCCTTTAACGGGTTTGCTTTTACAAT
TCACAACCACGTTTAATGACGTAGGCATTTGTACCACACATTTGTCACCTTCAACCGACCAATCAGAACGCTTTGTAAACTGCCACCATTGTTTTTGCCA
TTCCTGCTGGCGTACTCATGCAATTACTCACAAACAATGTGACGGCCGTGAAGTGTGGGCATTATTCTACGACGTGCGTCCCCCGCACTCGTCCTCTGCC
GTTCCTCGTATGGCTCCATCCACCTCCTACCCCTCCAAGCATGTGTGCTTGATCCTTGTCGTCCTTTCGTCCGTGTTATCCGTGGACGCGGCGGCGGGCG
GCGTCTGCTTTGACGTGGCGGACGTGGGCAACATCGACAACCATTTCCGTCAAATCAAGACCAAGTTCTCGGCCGTGCGTGTGTACGAGACCCAAATGGG
CAACACGAACGCGATTGCCGCCGCCGCGAAAGCAGGACTTCAAATCGCCGCGGGTGTATGGATCCGTAGCGGCGACGCCAAGATCCAGGCCGACATCGAC
GCCGTGGCCGCCGGCATCAAGGCGTACCCCGGCACTGTCGTCGCCGTATACGTGGGCAACGAAGACCTAGCCAACGGCGTGTCGGAACAAACTGTGATCA
ACAAGGTGAACCAAGCGAAGGCGAGTCTCAGCGCGCTTGGCGTGCCGATCGGGTCTGTGCAAGTCGACGGTGATTTCTTGAGCGCCGGGCGACTGGCGGA
CGCATGTGATGTCGTGGGAGTGAACATCTACCCGTACTTTGGGTCGTCGCCCGACTCCATCTTGAAACCCATCAACGACCTCAACGCTCGATGGAAGCAA
GTCACGGCCAAGTTTGGCGGCAAGGCCAAGCTCACGGAAACGGGGTGGCCCACCAGCGGCACGTACAATGGCCACGTCGGCAGTTATGACAACGCCAAAG
CATACTGGCAATCGTACTCGGACTGGTCGTATGGCAACGGGGGCGGTGTGCCGTTCTACTTTCAGCACAAGGACATGCCAAACAAGTCGCCCGAGTTCGA
AGCGAACTTTGGCCTTATCGATAGTTACGGCAATTGGAAATTTGACGTCGCTCCGGCCACACCTCCGCCGACCGCACGACCTACATCCCCACCTACGGCA
CCTCCGACTGAGCCCCCAACTCAGCCGCCGACAACTCAGCCGCCAACTCAGCCACCGACAACTCAGGCGCCGACAACTCAGCCGCCGACAACCGCTGCAC
CTACAACGACTGTAACGCCTGAGCCTACCACGACGACCGCGGCCCCGACAATTGCACCTACCACGGCCACGCCTGAACCTTCGGTTACACCCACGGTAAC
ACCTGAACCTACGGCAACACCTGAACCTAACGTTACCACAACACTTGAACCCACGACAACGTCGGCAACAACCACACTTGTCCCGTTGAATGGAACCAAC
ACGACTTCGTTGGAAACGGTCAACAGTACATCTGGGGATGGAGTTGGGGATGGAGTGACGTTCAACGGAATCAATGGGACGTTCGATGCAATCAATGAAA
CATTTGTGACTTCGATTTCTGACGGTGCCTCGAACCCCACTGGCGTATTGATTGGAAGCGCGGCTAGTGGTGCTGATGCTGGTGGTGATGCTGCTGGTGG
CGGTGTGGCTAGTGGCGGTGCGACTAGTGGCGGTGCTGCTGCTGGCGCTGGGTCGTCGAGTTCCTCCAGTGCGACATCTATCGGAGGGACGGACAGTACC
AATATCAACGTGTCCTCTGCCGATTCGTCTTCATCCAACCCCGCCCCGACGATCTTCTTGACTGCCGGAGGCGCGCTTGCAGTCGCTGCTGCTGCGTTGT
TTGTGGTTCGTCGTCGTGCCCAGTCGTTGGAAGAGGACAAGGACGCATTCGATCCTGAATTCGGTCTCCATACGCCTCCAACGGCCCTCGGTGGCTACCC
GACTCAAGTTTTCACGACCCAGGCAAACGCAACCCCCGTCGCCACTGCTTCTACAGCGCCAGGCCCAGAACAGCGCGATCCCGGCTTGTTCAACCCCAAG
GACAGCTTGGACGGAGTTGCGATGCTGGAAGATCGACCCAGCACAATGTTGGACAACATGGGCGACATTCGCGGGTCGGAAGACTCCCTTCATGGCGCAG
GCGATGACACGCTTGCCTCGGACGAACCTGCCGCCTTCGACAACCGAACCACCATGGACCTCCTTGACACTGCGCGCTCGTCGACGGAAATTTTGCTTTG
AGGAGAAAGGCCAAGTCGATAATTTGAGCAAGTTTTGTTATCTTTGGTTTTGTATGTGTATACAATGTACAAATCATTATTCCGAAAAACGCGCGAGCTA
TTTTGAAACCCACCTGATCGCTGATTGGGCCATGTCAATCTTCTTGGGAAACATTC