Description :
From Genome Similarity Track
Location :
Scaffold_234:15910- 18147
Transcript NameFunction/comments
Phyag_g3775conserved hypothetical protein
Phyag_g3776conserved hypothetical protein

Sequence
2237 bases(100 bases per row)
TGGAAACTCGTCAAGTCGAAAGACCAGATGCGGGTCTACACGGAGCGTCGATGGAAGCGACAATACCCTCCAACGGAAGGCAATTCGACGGAAGAATCGG
ATCTACAGTCGATTTTGTGCGTTGGGTTAGCCCCTGGTATACTGGACGACATCATGTTTGGTGTAACGAGTCCGACACTCGAAGTTACTCGGACCAAGGC
CTCGTATGTGGGCGATCTCAGCGGAACCGCAGTCCTGACAACAGTGAAAGAACCGACGTCCGAGGACCCGTTCAATTCTGTCGCTGCGAAGTGGATGGAG
CTAGATGTGCGCCGCCGCTCGATGGGGTTCGTCAAGAACCGCGACTATGTTTACGTGGAAGCTACGGGGATCAAAACTCTTCCAAGTGGAGAGCGACTGG
GTTACCACGTCATGCACTCGGTGGATATTCCTCAAGCCGATGAACTACCAGGCCGCACTCGCGCCAAACTATCGGTGTGCTCGTTCTTTCGCCAAAGAAG
AGATGACACCGTTTCCGTGTACGTTATGGCAATGATGGATCCGATGAGTGACAAAGTTCGGCGCCTTGTGGTGCCTTGCTTCATtaagacgctgctgtcg
acacTCAAGTACGCGCATTGCGGAGAGATGAAAAAGCTCTCTCAGGCGCTTAGCGACAGGTATGCTGAATTGAAGCACGTCGGACCCCCAGACCCGGACC
GCAACTGCATCACGTGCATGAAGCCAATGCGCGTGTGGAAGTTCGGCAAATTATCGACCAACCACAGCACCTGCAAACTTTGTTTCGGATACGtatgcag
ctcgtgcaagcTCGAGAAAAAGTTGAGCTTCATGACGCCAGACCTTCAGATGACTCGACGGAAAGTCACTTTTTGCTCGTCGTGTGTTAGCGATGCGATG
GCAGCCACCCCGTCCGAAATGCCCAAACCAAGCAATTGCTGGAGCCACCTCGACAGTTTTTCTCGACCACGCAATCCGTCGAGTGGGTCGTCAGGCTGGG
GCACCGTCCTGGACAACGAGGCATCCGCGGTGTCCTACGATTTCGCGAAtacgagatgaagaaaaaaGCGTTCGATCGAAGAACGACTGATAGAGTGTAC
TGTAGTTGCATTCGGCAAATATACGAAGTCGGAGTGCTCGAGTCCATCAACTATCACTGACGCGACTCGTTTGTACCATTACTAAGTATCAGCGTGCAGT
TCGTTGCTTACTCTTTTTTTCTTCTATAGTTTTGACCCTGTCTTTCGATGCGGATCAACTTCACGATAGCAACCGGATCCAGACAGATCAAATTCCATCA
AGTTGAATGCCAAAGTCATCGAATGTTTTGGTTTTCAGTTCTTCCAGTTGGTTCGTTTGTCAGATGTACAAAAGACGGTTCCCAAAAAGCCAATCTGCGA
TCCGAGAATCGTATGGTTGCATGCATATCTCGCCAAATAATCATTACTGGGTGACGATCAAATTTACAACGTTTGCATTTCTTCCTACACCAATCATATC
CAAACGCGGCACTAGCTCAAAACGTTGCACTTGCGTTTGACCGATTCGGATCACCATTCGTGGATACCAAACACCAGAACGAAACTTTACCACGAAAACA
ATGACAACCACCAAATTATGCAACTTcactttgcagcagatgaCCGCGTATAGCGGAGGCAACATCGACCGGCTGCGTATGAAGTCATAGCGTCCGCTCC
TTCACTCCACATGGCCGAGTAGCTCACATCCGTGGCTGTGCGACATCGTCATTTTCCGGCTATTACTGCAATACACCGAGAGTGCTTGACCATTCGCGGA
TTGCTTCGTTTGCTCACATATCTATCTGCACAGTAATGGCGAAAGGGGAGTACGTCGCGAGTCCATTGCGGCGGATCAAACTAGCCCCGGCAGACGTGAG
CGAGCTTCAAGTCGTCGCGGACGCTATCCTCGACGCGAACCTGGAGAGGTACCAGCACTTCACGGATGTCAACAACAGTAAAGTCGATTCGAGAGCGTGG
AAGTACATCAAGGCCAAAGACCAAATCAAAGTGTATGCTGAACGGCGACAGAAACGACGTCGCTCGGCGTTCCAAGCGACTCCGGTGAGTGATGAGGAGC
CCGAGTTGCAGTCCATGATGTGCGTTGGGTCGACCCCTGGGAccctcgacgacgtcatgctgGGCATCGTCAGTCCGACGCTCGAGTCCACGCGCACGAA
GACTTCGTTCGTTGACGAACGTAGCGGATCTGCAGTG