Description :
From Genome Similarity Track
Location :
contig_194:15905- 17030
Transcript NameFunction/comments
g14717.t1hypothetical protein

Sequence
1125 bases(100 bases per row)
GGAGGGCAGCATCGCTGAGAACCACTGAACTCGTCGAGTCCTTCAACAAGACCATCCTTCAGCTTAAGGCTCATGCTAAGGTGGACTTGCACCTTGAATC
CGAGCGAACTCTGGCTGCCGAAAGGACCATTCAAGGTCTCAACGCCGAGTTAGCTGCTCGAGAGCGGACTATCGATCAGCTTGGTCGACAGCTCGTCGAA
GCGAATGCTGCGCAGACTGTTCTCCGCGGGGTGGCGACGAAATACTTTCGCGACGCGCAGGAGGCTGCCGTCTTGGCGTGTTCGGGTGGTGACTACGCTC
TGGCTAACGCTAAGCGCACCATCTCAAGACAGGCTGAGGTGATCTTGAGCCAGAAGGCTGTGATTCGCCACAACGGCCGTTATCCGGTGCATGACCCCCA
CTTGGCGGTTGCTGCACTTGTTGGAGTTGACGTGCCTGGGCTGGATCCGCGGGATCTTCATCTGAACGCTCGGTTGTGCCGCATCCTCGCTGAGCGCTTC
CCAGAGTCGATTGAGCTAGCCGGTTCGACGAGTCCCAGCGAAATCACTCTCCGGATTCGCCCGGTCAGCTCGTCGATTCCAGCTTCTGCCAGTTCGCCGA
GCGGGGTTCAGTCTAACTCAGCGGGTGTTACCCGGCCGAGCTCAGCGAGTGATTTCCCACCAAGCTCAGCGAGTGCAGCTTCTGGGACTCTATCCGGTCG
TTCTCGTTCCACACATTCTCGTCGCCAGTCGCGTCGTCAAAGTCGTTGTTCGGTCTCCCAGTTGCGGAACGCACCACTCCGCGATCTGACCTCTTCGGAG
CGTCTTCGCCGATATGCGAATCCTGCTTCCCCCACAGCTGCTGGCCCCCGTCGGAGTCGCTCGAAGAGTGTTCCACGTAGTCTCTACAAACGTCCGGTTC
CTGAAGAGGGTTTCGACCCTGCCACAACTTTGCTCAGTGCTGAGGTGATCGACGAGTTTTCTCCTTCTCTCCTGATCCCTGGTCGGAAGCGCCTCCGAGC
CCCGGCCTCCAGTCTGCTCGGGCCTGGTTCGTTGGTTACCGCCCTCAGCGACCTTCGCTGAGTCCTTCCCAGAGTCCCGTTTCGCCGACAATTACCGATT
TGGCAAACCTTCGCCCGATTCGCTG