Description :
From Genome Similarity Track
Location :
Scaffold_446:15905- 16958
Transcript NameFunction/comments
Albla_Nc1413197060S ribosomal protein L6 putative

Sequence
1053 bases(100 bases per row)
ATCTAAAATTTCATCTCGTGCACGATATCTTTCTTTGTGAGAGAGAATTTTGCATTCAGATAAGCTTTTAAGAGCGGTTCCGCCTCAATCTGATTGATGA
GCACTTCGTCCACTGCTTTCTGATCCTTTCTCCGTTGATCGCTGATGACAGGAGCCTACAACACAAAAAGCGTCAGCTTGAGTTGGGAACTTTATCACAG
CGATTCCAAGCGCCGATAGAATGATGAGCACTCGGGCGCTAGTATCAAGCGCCACTAGAATTGGAAGCTATTTTACGCACCGAAGTCGATTGCTCAAAGA
ATTGATCTTCTTTGGAGCTTTTCTTCTTCACTTTCTCCTTTGCAAAGTACGAATCATCAATGTCGATGGATGGAACTCCCGAAATGTCAATTTTGGTCGA
AGTGGCGATCACATACGCTTGATTGACTCGTCGCAAAGGAACACCATTGATCTTGTAAGGACCTATATACCCATCATACAGTCAGTATCAACTCGTTGAT
CTTGTGAATTCTCAGCTCTCATAATCTTGCATATCTTTGGCAGAAAAAAGCCTACAGCGCAACTCACACTTTACCCACACTGAACAAAAGAACAGGTCGA
AAAAGCGCTCGCCGCTTCCAATCGAATGTATAGAGACACAAGTCTCACACAAACGACTGACGTAAGCTGTTGACCACCTCTCGTTGTCAGTTTGCATCAT
CGAATTCCGTCTTCACACAGAAATGACGTACCAGTAACCAGTAGAGTTCCCGACGGAAGCTGCTTCAAGAAGACGACACGTTTGCCACGAAAGCGACCGG
ACAACAGGATCAATACAGTTCCTGGCGTGATGGATTTACGCAATACAGCGGTCTTCTTACTGTTTCGTACAGTTTTTGCGGACGCGAGTCGCTTTGGAAT
ATAATCCGCCGGGTACCATTTCTTCTTGTTGGGACGTGTTTTAGGCGCAGCAACCTTCTTTTCTGCCTTCTTCTTAGCGAATTGGAATCGACCATTTGTA
CGTGCCAATGAGTTGGATGAAATGGCGTTAATTCCGCGTGCAAGCACAATGTT