Description :
From Genome Similarity Track
Location :
Scaffold_13:1590077- 1592330
Transcript NameFunction/comments
Physo_3577781-phosphatidylinositol-4-phosphate 5-kinase

Sequence
2253 bases(100 bases per row)
TGGAGAAGCAGCAGCCAAATGGGGGCGTACGAGGCGCTGGGCCTGGCGCAGGCCGCGCAGGTGTATCTGCTCGTGGGGCTGCTGGGCGCGGCCGTGTACC
TGCTGCTGGTGCTGTCCTTCCTGCTCGTGCCCAACATCCGCGCGCAGCACCCGGCGGCCAACCTCGTGGTGTGGCACGCGGGCTGCGGCCTCGTCTCGAG
CGCCGGTTTCGTCTTCGCCTTCGCGCTGCAGCGGGACGACGAGGACGGGGAGGCGGACGCGGCGCTGGTGCAGCGGCAGTGCGCGCTGCTGGCGCCCTTC
AACCAGTTCTTCCTGCTGGCGGGCGCGCTCTGGTACCTCATGCTGGCGCTCGACCTGCTCGTGGCGCTCGTGAACCCCTGGATGGGCTACAGCTGCAAGT
CCTGGGCCTACCACACCATGTACGAGCGGCCACTGGCATTTGACTCGTAGCATTCCTATAGAGAGGCGTTGACTGACCGACTGACGGACTGACTGACTGA
CTGCCGGCAGCGTGTGGAGCGTGAGCGGCGTGTCGGCGCTGCTGCTGCACCAGCTGCAGCTCTTCGGGCTCTCGCCGCTCAACGTGTGCTGGGTGCGGCG
CACGCGCGACCCGGCGCAGGTCAACACGGCCAACTGGGTCTTCCTCTTCGGGGCCGTGGGCGGCATCTGCCTATTGTCGCTGGCCGTGCTGCTCTTCGCG
AGCTTCCGCTTCGTGCGGCGCCAGCTGGACGTCACGTATCGCGCCAAGCGCCGCAACCTCGTGCAGTACTACCGCTACCTGCTCATCTATGCGGGCCACT
GGGCGGCCTGCGGGGCGCTCTACTACGCGGCGTACCGCCAGCAGTTCGACGGCAAGATGGCCAAGCACTTTGAGCTCGCGATCGCGCTCGTGTTCGGGTC
GTACCCCGTGCTGCTGCTTTTCGTCTGGGTGCTCAACACGGAGCTGTACCAGAACTTCTCGAGCGAGAACAATCTGTCCAAGGCGGAGCGAGGCGCGGGC
GACTCGAAGAGCACAGAGCACTTTAGTGCGGCGCTGAGGAAGGATCTGATGCGCTACACGACCGCAGGGATTCGCTGCAGCATCACTGAGTCCCCCGCCG
ACAGTCTGCGCTCGCCGCTGCTCAGTCTGGCCCGCGATCGCTTTGGCTCGCTGGATCGCACGGCCGCGCTGTCGTTTCTGCAGATGGAGGAGGGCGGATC
GGCCGGTCTGTACCACGAGAAGAAGCGACTAGCGACGACGGTGTACAACGGCGAGTACCGGTACTACGAGAAGCTGGGCTTTACCGACTACGCCCCGAAA
GTGTTCCAGAACATCCGCGAGATTTGTGGGATCGACAACGAAATGTACGAGCAGTCGTTCGCGGATACGCTCCTGGAGCGGGCGTCGGAGGGCAAGTCTG
GAATGCTCTTCTACTTCACCAGCGACCGGAAGTACCTGGTCAAGACTATGACCAAGAAAGAGCATTCGTTCCTGCTGGAGGTGCTCCCGCTGTTCCACCA
GTACATTCTAAAGCAGCCGAACTCGCTCCTGTGCCGCTTTCTCGGCTGTCACTCCATGCAGCTTCCCGTTGGCTGGAACAAGATGTTTTTCGTCGTGATG
GAGAACATTTTCCCGGACGGACCAGTCGACGAACGCTACGACCTGAAGGGCATATTCCACCAGTCCAACTTCAGGTACCAAGAAGGGATCGCGACGCCCG
TGTCAAGCGAGTGGAGTCGAAGTGCGAGGGAAGAAGAAGGTGTGGTGCACATTCTCGATGAAGATGAAGCAGCGTCCAGCGAGAGCCAAAGTGTGGACAG
TGAGATGGGCCACGTAACAGAGAAACAACCACTGTTACGTCGTGGAAGCTCACGCCCATCGCTTCGTTACGACAATGACTTCGTGACTCGCCGTGCCTCG
CTTCGCGTCAACCCCACGACCCGTGCGAATTTGCTCGCCCAAGTGACAAGTGACTGCGGATTCCTTCAGGAGCTGGGGATCATGGATTACAGTTGCCTGC
TTGGCATCCGACATTACAACCAGCGCATTGAACCGGAGGTGATGGACAACCTGGCTCACAATGCCGTCGTGTCGGCTGACCAGTCCACTGTCTACTATCT
CGGCTTTGTGGACATTTTGCAGCACTACAACATCGGGTGGAAAATGCAGCACTGCTTGTTGGCTGCTGTGGTGGACAAGCGCCAGATCACGGCGCTGCCT
CCAGCTGAGTACGCGCTGCGATTTTTGAACTTTATTCACGAATATTTACTGCG