Description :
From Genome Similarity Track
Location :
Scaffold_3021:1590- 2636
Sequence
1046 bases(100 bases per row)
TACGAGGAGTGTGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCTAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGA
TCCTGGGGCAGCGACAGCAAGCAACCATGGCATATCGTCCCCAAGCTAACGGATCGGCCGAGCGCATGGTGCAGACGATCACGAGAGCACTCAAGATGTA
TGTCCAGGATTTGCATCAGAGGGATTGGGATGAGTACGCAGAACGACCCTTCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTT
TACTTGGTACATGGGTGGGATCCCAAATCCACTCTAGAAGCGGCCATTCCGGTATGTAGCACCAAGAAGAGAAACCGAGATTCAAGGCGGATGGCGATAC
CCAGTTCCGAAAATATCTACCGGCCAGCTAAAATTCAGGGTGAAACGAACGTATTGCGGAGTGGCGATACAGGATTCGAGCGGATCGAACACCACGAAGA
ACGCCGGACCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTTATTTGGAATCAAGTGAAAGAAGGGTACGCCCGGCAAATTTGCCCCATCTATGGC
ATGGAACGTTTCGGGTGAGCCGAGAAGATTGGAGAACATGCGGTAAAGCTGGAAACGGCAGGTACCGAAATATCGCCTGCTCCCTGTAGTACACGTATCC
AAGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGGATCCGATCGCGTCGACTTCGACGAAGTCCTCCTACCGGAAG
ATAGTTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAGTTGAGAAGATCACCGATATGAGGTTGGGGAAACGAACTAGATACGGACGGGTTTACCGTGA
ATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGAGGGATCGTACG
AACCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGG