Description :
From Genome Similarity Track
Location :
Scaffold_1525:159- 3534
Sequence
3375 bases(100 bases per row)
TTTGAACCCTTAATGCTTTACAGCTTTACATCCTAAGTGTAACGTGTTTACCAATTTCACCACTTTGATAATAAATAATACCTACTATTGGACTTGAACC
AATAACCCGTTAATGGGAACAGATTTTAAATCTATCGTGTTTACCAATTTCACCAAGTAGGCTTGTTATTTTTTTTAAATATATGAAAAAAAATAAAATA
ATAACTTATCTACAATTACATTTATTTGAATTAAAATATAATTTTATTATATTTTTAATTACTTTTTTTTATCTTTTTATAATTTCATATTATTTTTCAG
ATCAATTAATATATTTATTAGTTAATAATTTACTTAATAAAAATATGTTAAAATATTTTATCTTTACAAATATTACTGAAATTTTTATTACTAATTTTTT
AATAGCAATTTTTATATCAACTTTTATAGTAATTCAATTAAGTATTTTATTAATTTGGTTTTTTTTATCAGAAGGTTTATATAAATTTGAAAATTTTCTT
TTTATAAAATTTTATATTTTTTTTATTATATTTAATTTTTTTATAATAAATTTAATTTTCACAAATGTTATTCCACATATATGGGATTTTTTATTAAATT
TAAATTTTTCTAATTTATATCTTTTAACTATTTATTTTGAACCAAAAATCAATAATTATTTTGATTTTAAGATTGTGTTGGGATTGGTGAAGGCGTGTAC
CGTACGAACGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTCGGGGATCTCGCTGGTCAAGACGCCATCC
TTGGGATGGATTTCATGGTGCCGGCCGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCG
GCCGTTGTATGGAGCGAAGATGAAGATCATAAGGGCGGATAAGACCACCTGGATCGAGCCCGGGGAAACTTGGGAGCTGCCAGACCGGTTAAAGTGGGTG
GAGCATGAAAGACTGTGGGTCACCCGGGGCGAGAAATGGGTACCTACCGTAATCCAAGGACCAGGTCGATCGCAGTACCTCCAGGTCACGAACGTCAGCG
ACAAGAGATTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTGGCGAAGGACGGTATCCCTAGACGACCTGGATATGTGTCAGTGGGATCCCGCCG
CTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCTCTCGCAGAGGTGGAGCTCCCAGCGGAGCCAACTGGCCCCTTGGTGGAT
CGGCCTTCATATCCAACTCCGCGATAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGGATGTTGGATCCAGGACGGGGGACGATCCCCAGA
GTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAGCAGCCGGATCCCGCTGATCCACAAGTGGATCCAAGCTCTCC
ATTGGATAAAGTGCCTGGATCCCAATCGAGAGTGGCAACACTAGTCAAACCCGAACTGTCGGGCTTAAACTCGTTAGAGGACCAACTGGATCCAACTGGT
GGTTTCCCTGATACCAGGGTACCTGAACCCCCGAAGATAGAAGGACTGCCAGGCGAGAGAGGGCCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAGA
CGGAAGATGAGCAAGTCTGTTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGA
AGAAGTCACGATTGATGATATCCAAGTGGATCCGGGGGCAAACGAATCCGCGGAAGTGGATCGGTTACGTCAGAAGATCTAGGAAAGACGACATCTGCTG
ATTGGTAAAGGTAATGCATTACCGCCCGCTGCCTGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGG
CACCTCAGTTCCGAGAAAAACTATCGGACCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCGACGTCCCCGTGGGCATCCCCAGTGGTAAT
CAATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACGCGATTGATGGTGTATACAATGCCCCTAATCAA
CGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACAGTTCTCTAGACATGGCCAGTGGTTTCTGGGTGGTTACTATGACGGATCGAGCTCGCGCAATA
TCCGCATTCATCACCCCGTTTGGCCTGTTCGAGTGGAACCGGATGCCGTTCGGATTGAAGAACGCACCCCAGATCTACCAACGCCTGATCGAGAACGCCC
TCTATGGATTCACCCGAATACCGGAGTCCAAAACAGGTGGGTCTGGGGAAGGCCATACGGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGG
GACCCCATCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTGATCCCGGCGGAATCGTGGGATCAGTTGTGCGATAGAGTGACGTCCTTACTGGAG
GCGTGTACTAAGTGGAATCTCTCTATTAGGGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGAGTACTTGGGCCATCGAGTTTCCAAGGAGGGATTGG
AGGCGAATCCTAAGGACAGGTCTTCATTAGCCGATTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCTTTCTTGGGCAGTTTGAACTACTACAGTCG
GTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTACGAATTGAGAGAGGTAGATTTTGCCGCGATGACCACTCCAGCTGTCCAGATGAAAATCCAA
CAAGCTCTGGCCCAGGAGATGCCGGATCCACGAAGGGATCCAAGTGGTAGGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGACCAAC
AGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAACATGGAACAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAA
CAGAATCGCGACCACGCCTATCCTCCGTCACTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTT
CAAGAACAAGAGGGGGTCTGCTATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGC
TCCTGCGCGTGTTGGATCTGAATTACAACCTGCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACTCCACGC