Description :
From Genome Similarity Track
Location :
Scaffold_739:159- 3526
Transcript NameFunction/comments
g17505.t1hypothetical protein

Sequence
3367 bases(100 bases per row)
GCAGTGACCGAGCTGCCATTCCCTGCTTCAAAAAAGGGGATGCAATCTTTCCTCGGTGCGCTGAATTATTACAGTCGATTCATCCAGGATTTCGCAGTGT
ATGGAGCAGCTTTGTACCAGTTGAAGGACGAAGACTTCACGTCTAGTGGCAGCCTCTCGGCAGCCAAACGAAGCTTCGCCGCGCTCCAACAGAAGGTTGC
AGAGGCACCGATCCTCCGGCACTTTGACCGAGACAAGGAGGTGCATGTCACGTTATTCGCGAATGAGTGGACATTGAGCTCCACTTTGATGCAATACCAT
GATGACAAGCTGCACCTGGTTCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTCTTAGCGCTACTACTGG
TGTTGAAAGTGTGCTACTCCCAGTTGGTGGGTCGGACCATCCACGTCTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCCAAGACACTGTTCGG
TCGAGCGACCCACTTCGCGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGTACGTTTGCTCAGCTTCTCCAAGCTGGC
CTCACAAGCTTCGTGGAGTTGGAAGACTCGTTGGCCCCAGTTACACCGCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCCACTTGCTTTATGCCT
GCCTACCGAGGTCCTATACCGGATTGGTGATGTCGTTCGATGGTTCGGCCAAGACCGAAAAGAACGGTGGATATGGCAGTTGCTCGTGGATTTTGTGGAA
ATTACCAGAATGGACTGTAGTGACGGCTGCGAGTGCTTATCTCGAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACAACGGCGTCTCAGCT
GCGCTCGAACATGGAGCCGAGGATTTAGTCATCGTGGGAGATTCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGA
TGGTTCAACTGAATCGTCACCGAGAACTCACGACCAAGCTGCGGTCGGTGAAGTACTTGCACGTGGTCCGAGAATTCAACGCTGCAGCAGATTCGTTGGC
AAGCGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCTTCGACCGAGGCTAGGAAATTAGAATTGGTCAAGCTGAACCGGATCGGAGAGGTCATCTATGAA
CCCTCAGTACAGACCACGGCCGAAGAGAAACCGACAGTCAGCTTCGCCCGAGCCCAAGTAGCCCGTGGGATCTCCCGCGACAGATCTTTTTTCGACTTTG
TGCGGGACGAACCCGACTACCTAACTGCAACAACCAGAAACCAAGCAAAAGTGAGGAAGAAACGAGTCCAGTTTGCAGATGAAACGTCGGTGATAGAGCC
GAATGGTACGGCTGAGCGAGACGAAGCGAATGGTGTGACCACCGAAGCTCAGAGTGAGCTGAGAGCCGAGCAATCGAGCAACGAGGGCGACCCTGGCGCT
CCAAACGCAGAAGACGTTGACCCTGTGGTTATACAGGAAGAGCGCCGGAGACGAATCTCCGCCGCCCAGGATGAAGAGCTGAGATGGTCGAACCTAAAAG
CGGTCCTCCGAGGCGAGGAAACAGACCTAAGCTACAGAGCAGCCAGAGACGCTTGGAAGATGGCCGACAAGTTCGTGCTTAGCGAGGATGGTGTACTGTA
TTTTCTTGGAACGAACCGTCGGTGGGGAAACGAACGCCGAGAGGAGACAACGATGCGTCTAGTGGTGCCCACAACGATGATTCAGGAAGTACTACGGAGT
TGCCACGACTCGTTGGAAGGGGGCCACCAAGGTATCGGTCGAACGTACCACCGAGTCAAATCAGACTATTTTTGGATTGGACTATATGCAGACGCCGAAC
GACACGTCAAGTCCTGCCCCGACTGTAGTTCGAGCAAAAGCCGACCACAGTTCCGAGGCTATTCGCCAGGAAATGTCTTAGCAGAGCGACCGTTCCAGAT
GGTGTCGATGGATTTCGTCATACCGTTACCGAAGTCTCGTCGGGGCAACTCAGCCCTACTACTGTTCCAGTGCGCGTTCACAGGATTCGTCATGGGTAAA
GCTATGTCAGACACTACCGCCCTGAGGGTCGCACAGGCTTTCGAGGAATGCGTGTACCGAAGATTCGGAGCACCAACTCTGATCCGACATGACCGAGACC
CTCGCTTCATGAGCGAGGTGTTCCAGACCTTTGCAGAAATGATGCAGTCTCGGTCAAGAGCGACCCTGAGCTATCGGCCGCAGGCGAACGGACAGCAAGA
GAGGTCGGTGAAGACGGTCATGCAATCGGTGCGGGTGTACGCAGAATACCCGCTGCAGCAAGACTGGGACGAGATCGCGGAGCGATTGATCTTCGCTATC
AACAACTCTCAAGATGGCACCCGGAAGGACACTCCGTTTTACCTAGTTCATGGATGGGACGCACAATCCACGCTGCGAGCGATGTCGTCGTCACTCAAAC
GAGGATTCGGAGGCCAGACTGACGCATTGGCATGGCGCCGAGAAGTGAACCGGCAACAGGAAATCTCGTGGAAAATGGCAATGGAGTACCAAAGTGTCGA
GAAAGCTCGGAGGGCGAGAGAACACAATGAGTCGCTGGAGCGACGTGAGAGAGCTGCAGTACCGAATGTCGACGAAAACGAGACTTCTGACGAGTCACAG
GTGGAGACGGGGGCAACATCGGATCCCACTGTCGAAGGACCGAGGTCTCTGTTCCAACCCGGAAGCAGAGTTTGGTTGTATATGGAACGAGTCAAGCCAG
GGTTGACCAAGAAGCTCGCCCACCGATGGCATGGACCATTCAGGATCAAGAAAAAGATCGAAGAGTTTGCGTACGAGTTGGAGTTGCCAGACCGAAGTGG
GTATAGGTTCTACCCGGTGGTGCACGTGTCCCGACTCAAGGCCGTCAACGAATTTGGAGACCGACCGAAGAGTCAGTTAGCACCTGAAGTGACCGAGGAT
ACGAGACTGGACTTCGATGAGGAGTTGTTGCCTGAAGATAGCTGGGAGCCAGACCAGCTCGCTGGCGAATATGAGGTAGAAGCCATCCTCGATGACCGAT
CCCCGCTGTCGACGGGCACTAGCCGCGCTGTCCGAGAGTTCAAAGTGAAGTGGAGTGGGTATGATGAACCCACGTGGGAACCTGCCTCAAATTTGTCATG
TGGCGGGCTACTTTATGATTATCTGCGGACCCGGCGTAGCGAACGACGATTGCAGATGGTTCAAGTTGCTGATGAGAACTAATCTGGAGAGCTACCGAGA
GTTGAACTGTCTACGGGGGTGATACAGCCCGTAGCAACAGATGAAATTTGCTACTGTATCAAAATTG