Description :
From Genome Similarity Track
Location :
Scaffold_666:159- 2513
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_666-fgenesh-gene-0.2NudC domain-containing protein 2

Sequence
2354 bases(100 bases per row)
CTCAGGCGTATTTCACGCCGCCCATGAACGTGCGCGGGTCTGGCGCCGAGCCGTTGAACTCGGCGCCTGAGAAGTCGAAACCCGGGTTCTCCTCCTGGAA
GCGCTCGAGCATCATCTGCCGCTTGGTCGCCTCCTGCTCCATCGGGTCCAGCTGAAAAGACGCAGTGCAAGCGATACATTAGAAAACGATTAATCATTAT
CTCAATGCATGAGCACAGACAGACGCGTACCTCGCCATGGCCGACAAAGACGCTGGACCACATGAGTCCCTTCTTCATCTTCTGCAGGTTGATAGTCAGC
TCGCCCTGGTCTGCATAGCATTCAACAGAGTCAACCAAGCCCAATCGCATCCGCAATACACTTGAGCCAAACGCAATACTTCAGCACGCACCGAGCATCC
AGTAGCTTTCTGCGACCACCACGGCGCTCGACAGATCGTGCTGCAGATAACAACAAATAAACCAAAACGCGTGACCCACAAGCTGCATTTCAATCAAATA
TCCCAAGCGCCACGCACGTTGAGGAACTTGTCGTTCGTGCCGCGCAGACCCAGCGTCACGTGGCTCGCAGTGATCTCACAGAGGACCGCGCTGGCAGGGA
TGCCCGGCGGTGGGCGGATGTACACGTTGAGCTCCTCGAGCGACTGCTCCCACTCGTAGATCGCTTGGCCTGCGTCACGACACCCAAGGCGCAAAGCAAA
GCAGGCACGGTGTAAGAAGTGTATGCAAACGCATCATGAGTGTATGTATACAGCCTCTCTCTCTACTCGTACAAGCCCTACCGTTGTGCTTAAATACTCG
TCGCTCCACGCTCGTCATCCTCTCGTAGCTGCTCGCAATGTGTGGAAATGTGGAAATGGTGATTCCAACAGGTCGTTGGAGTCACCTTCGCGCAACATTT
CGCAACATTGTCATCCGAAGTGCAGGAAAATCTTGAGCCGCTGGTCGCCTTCGTCGCGCACGCGCTCGTACGGCCACCAGTCCAGCAGCAGGTTTTGCAT
CGCGATGGCCGTCTGCGACGTCGACGCTTGCTTCATGGAAGCCTCGGTGAGTCCCATGCGCCGACAGGTCTGCAGCCGCGTCTCGCCAAACTGCTTGGCG
AGGAGCGACCGCACGCGCGCGACTTCCTCCTGCTTCCAGCGCGTAAACACGCTGGGCAGCGGCTGGTTCTTCTCGTCCGCTGCGAGGACAACTGCAACAG
TTCGAGCTATGCCTGTGCGAGGCGTGTCGCTCGGGAATGGGCTCCGGAGGTGCAATCGGAACGCGGGTGAGCGTGGGTCCTGGGGCTCGTACTGCTGGCA
CTCGAGCTGCACTTTCAGTCGCTTCGCCACGAGCGTCTTGTACGCTTCAGTCTCGCCTGCGAGGCGGTGCACGAGGTCGTCCAGCGCGCGGTTGTGGACG
GGCAGACTCGTCACATCTGTACGACACTGGGGACACGACAGCGACGAGCGGAACCAGCTGCTCACGCACATGCCACAGAACGTGTGCGAGCACGGGAGCG
TGACGCTCGAGTGGAAGTACTCGAAGCAGATGGGACACATCATGCAACGGTCCTGGTCGTCCAGCTCCTCCAGACGGCGGCTGCGCTTTCGTGGTGCGGC
TGCTGCTGCGTCGCTCACGTCTTCCATGGGCTCATCCGCGTGGCCGTGACGTGGCTTCTCTGGGCTGTCACTATGGTGTCGCTCGCGCTTCGTCGCGACT
GTGCTGCTCGTATGGCGGGAGGACGTCCTCGTCGGAGGCGGTGTCCGAAATCCTGGACTTCCGGGCGCCGTCACTGGAGTCACTATATTGCTATTTGTCT
CGATGGCTGGCTCTGGGGATTCGATCGAGTCGAGCTCGTCCAGCTGTACGGAGATGGTCGCGCCGCTCTCACGCGAGATCTCGATCATCATGCGCGCGCC
GTGTCGCATGGTGGACGCCAACACAAGCTCGTCGCCGTCGTGCAGCTCCATTGATCCGCCCGGAGGCACATCGACGCCATTGAGAGACGTGCCGTTCATC
GCCTCGAGGTCCTGCAGCACCCACCGCGTGGGCTTGGCGTACAGTAGCGTCGCGATCGGATCCGTGGGGACTGGCGAATTCACCACCCGAGAGTCGCGCA
CGGGGAAGACGCGCACGTGGAGCTTGCTGACCGTGCGCGTCTTGGTGGTCGTTGGGATGACCACGTCGCTGCGGCGGCTCCTGCCGATCGTGAACGCGTG
CGAGAACCGCCACGCAGGCTGACAGGCGCTGCTGCTGGTGGGTGTTACTGTATCTCGCTCATGTGCTGGAGATCTGCGTCGCGAGGCTGGGGGCGTGGTC
GTCATGGCCGTCACAGCGCTTCCCGCGCGCCCTCGATGCATTTTTGCGCGCGAT