Description :
From Genome Similarity Track
Location :
Scaffold_1787:159- 2306
Sequence
2147 bases(100 bases per row)
CCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGG
TGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTG
GCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGCGTATTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGAGCCTC
TAGGGTGTAACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACGAGTAAAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTATC
CAGTTATCACTACCAACACTAGATTCGCAATTCCCAACCTTCTCGGAGCTCGTACGGCCAATGTAGCTCCGGTTCTTGAGGGCAGGAAGGCACTTGCGTG
TCACTGTGCAAATTGGAGTCTGTATTGATATTTAAGCCTATACCTGCCTGGGTTTCTACCTTCTATGTCTTTCATCTGCTAAATCCCTTACCAGGCTCGG
CTGCATGTCCCTTCTTCCCTTGACCCATCATCCCAGCTGTGTTATCTTCAGATCCACCGGATATATGACGTAATCATCATGGTCACCCTATTATGGGTAC
ACTCATCCGGATCCAGGTCGCTTGGATCCACCTCACTGTAATGGTACACTCGCCGTGGATCCGAGCTCTCCAATCATCCAACATCATCTCGCAACCATCT
GTGATCTCCGTTGTCCCACGAAAGTTCGAGATCCACTGTATCCCTCATCCCTATACCCTGGATCCAGGTCCCTCCAGGCGGGATCCTCCCTCCTTGGATA
CGAACTCGGAAGTATGGGATCCGGGGTACCTCGCGGTGGATCTTGACTCTTCATTAGCTGTGGCTACTAGATCCACCGTCAGAGGGCACCGACCATCCTT
CCTTCATAGGATCCACACTCGATCCACTCTTGTATAGTATATCCCATATCCATCTTAGTGAATCCAGGTAAGGGTGGATCCGAGGTAAGTCTTGGTGGAT
CTTGCCTTCTCGTACATCGCTCATATCAGATCCATCGTCATTCCATACGGGGTGCTGCTCGCCATGGCTAATCCACCACAGGCAACTTGCATCCGTGCCA
AACAACCCAAATCCTCTATAATCACTTGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTCAGGACCATTCTCTTATTTCTGAGAAAGCACTTCACCA
CAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGC
AGCTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTGGAATACCTACATC
GACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACATGTGGATCACTTCATCGAGACGCTGGGAGA
TGTGGATCTGGCCGACAGGCTGACCCTGTTACGTCTTCCAGACGCAGATGAGCATGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAG
AAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCCACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTG
AGTCAGGATCCGACGGTTCGGACTCCGACCCTGAAGATTACCGTCGAGTCTGTCTCACTGCGCCCAACGATCGAACGGCGAAGACCGGAGACAACTCTCG
ACCGAGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGACAGCCCAGGTCAGGTGTTCGCAGTGCGGATCCCGGAAG
CACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCG
AGATTCACGACGTCGGCAAGTGTCCGATGGAAGAATTCTACAACCAG