Description :
From Genome Similarity Track
Location :
Scaffold_16:15899- 20207
Sequence
4308 bases(100 bases per row)
GTCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACCTCCACATGACAAGTTTGATGATGGT
TCCCAAGTTGTATCTTCATAGCCCACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTCGTCGTTAGTGGTGTTCTGTCGTCGAGGATGGCCT
CGACTTCATATTCGCCGGCAACTTGATCTGGTTCCCAGCTGTCTTCAGGCAGTAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAGTAC
CAACCGAGTGTTCGGTCGACTGCTGAACTCGTTGACAGCCTTGAGTCTCGACACATGCACTACTGGGTAGAAGCGATACCCACTTCGGTCAGGCAGTTCC
AGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCATGT
ACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGAAGCTCTTGCAGGATCTTCCATCTCTCCTGAAGCTTCTAGGGGGTCCGCCGAGTGTTC
GTTTCCACTTGGTTGGGGTACAGCAGCTTTTTCCAGTCGACTCAGAGCATCATTATGATTTTTTGCCCTTCGCTCCTTTTCTACAGCCTGATAATCTTTG
GCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTG
CCCGCAACGTCGACAGCGCATCCCAACCATGAACGAGGTAAAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACTAGCTTCTC
CGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGACCCCATCACTGACTTCACCGAGCGTTCCTGCTGTCCATTAGGCTGT
GGCCTATAGCTCAAAGTCGCTCTTGATCTTGACTGCATCATCTCTGCAAATGCTTGGAAAACCTCGCTCATGAAGCGTGGGTCGCGGTCATGCCGTATTA
ATGATGGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGT
GAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGAAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCT
AGTACGTTGCCAGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCTACGTCAGCGTACAAGC
CGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCTTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTGAAT
CATCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTGGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTCTTCTGAT
AACACGAACCGGTCAGCGTATTTCCAGGCATTTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTAAAGCACCTTCTTGATGTTAAACCACTTCT
GCTCCTCGTCTTGTGCCACCAGTATCCGTCTGCGTCGTTTCCGCTGTATCGCTACTGGGTCAACATCTTCCGCAATGGGAAATGCCGCTGATACAGTCTT
GTGAGGATGGTCTGGCAAATCTTCGCCGAATGAATCTTCGGTGGACGTCTCTCGTCGTTCTTCATTCTGTTCTTGAGCTTTTGAGACATCCTCCGAGTGT
TCATCTGCAAACCTGACTCGTTTCCTGGCTTTCGTCTGTCGCCGAGTCATCACTGCTATATTACCATAATCGCACTTTGGTGAGCTGTAATCAACCACGA
AATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCTCGTGATGAAACATTTACCGAGTCTTCATCCGG
CTCGTAGATCATTTCCTGGATGCGGTTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATTACCCGACTGACCTTCGATTCCAGCGCTTTAGTG
GCTAACGAATCCGCGGCCGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTGGCCGTGAGTTCCTTGTGAGTATTCAGCAGCGCTA
GCAAAGTTTCCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAACGATGACTAAATCCTCGGCACCGTGCGCAATAGC
AGCCTTGACGCCGTTGATCATACCTTTATACTCTGCCTCATTCACCGTGGTAGCCGAGAGGTAAACGTTTGCAGCAATCACTACCTTCCACTCAGGAAGG
CTCCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAACGACATGACGAATCCGCTGTAATTACGGGAAAGCC
TGGCGTACAGCAACGCGGGGTCCATTCGAATAGTCGGGGAACCCTTGTTTGGAGGCGCCACCGGCGCGAGCGAGTCTTCCAGGTCAACGAAGCTCGTGAT
GCTTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTAAGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCGCGCGT
CCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACA
GCAGAAGTAACGCCAAAACCTCCTTCTCAGCAGGATGATAGTTCATCTCGGCCTTTTTGAGCACCCGACCGAGGAACCGTACGGGGTGAAACTTGCCTTC
ATGTTCTTGCATTAGCGTAGTGCTCAACGTCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGT
GAAACACTCATCTTCAATCTCTCGAAGGAATGACGTGCCACAGAAAGGCCACCTTCAACGAGAAAGTTTTCATCCTTGAGCTGGTACAGCGCCGCACCAT
AGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGCTCGGTGATAGC
CGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAGAAGATGCTCTTGGTGAAGCTAATG
CTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATATCATCCACAAACGACC
GTTGACCAAATACAGGTACCAGCGATGATTCGTCTGATTCCCCGTTCGTAAACATGTCAGCGACGGGGCTATTGACGAGTTGTAGTACCGGGTCGGTTTC
TACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACGATCGGCGCTTGGTCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCCTC
TCCGAGTATTCAAACCAACCTCCTTTAGGTTGAACGAACCCCCAGAGTGCGTTGTCAATCGTACGCTGGTAGATCATCGGCGCGTTCTTTAACCCAAAGG
GCATGCGTAACCACTCAAAATGCCCTAGTGCGCAGACGAACGCTGACACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATC
CAGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTCACCATCTTG
TAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACGATCAGTCCTGCACGCA
ATAAAGCGCGCAGTAGCTCGGACAGCTTGCCGAGAAATCGCAGCGGCACGCGCCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGATATCGCA
TACCGCTCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGTTCTTTAGCGTTGCGACTAGACGTTCTCGGCGTTCAGTC
GACAGCTC