Description :
From Genome Similarity Track
Location :
Scaffold_228:15897- 20210
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_228-fgenesh-gene-0.13Peroxisomal 2,4-dienoyl-CoA reductase
Pytar_ATCC12531maker-par_contig_228-fgenesh-gene-0.4Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_228-snap-gene-0.22Conserved gene of unknown function

Sequence
4313 bases(100 bases per row)
ACGCCGCTCTTCATGAGCTCGGCTCTCTGGTCCGCAGACATGCTCCCAGTGAGCTTTGCCGTACCGACAGTGTCGTCGATAGGCCCGGGAGCGACACCGA
TCACACGGATGCCATAGGTGCCCCACTCAAGCGCGAGCGTGCGCGTGATACTGTCGACCGCGGCCTTGGCGGCCGACGCGTGGACCTGGTACCACGTCGC
CGGCAGCTGCAGCGTCGCCGTGATGTTGATGATGCAGGCATCGCCGCTCTGCTTGAGCGCGGGGAACGCATTGCGCGACATGTTGAACGTGCCGATCGCG
TCAATCTCCATGACCGTGCGGAACGCGTTCGTGCTGAGCTTGTCGGCGAGCGCGAGGAAGTTGCCGGCGGCACCGTTGACCAGCACGTCGAGCTTGCCAA
AGGTCTCGACAACTTTCTGCACGGCCGCGACCGCGTCCTTTTCCGACCGCACGTCCCCCGCAATGGCGATGGCCTGGTGGCCCTTGGCCTTGATCATGTC
GACCGTCTGCTGGAGCATGGCCTCGCGACGGCCCATGACCGCGATCTTGGCGCCGTACTCGGCGAGCTTGATCGCGATCTCCTGGCAAATGCCCGAGCCG
CCGCCCGTGATCAGCGCCACGCGGCCGCGCACGGCGTCGGCCTTGAAAACACGCGCAATCGCCGCTGCGTCCATTTTTGGGGAATGAGACGGAAGCCTAT
GGAAGGGGAGAGCCGCGAGTCGAAATGGAAAGTGCCCGTGTATCCGCTCACGAAACTTCAAGAGCTGGTCCCCCGATAAGTTCGTGCCCGTAAACCGTCT
CTGTAAACATTTTGATTTCGAGAATTTCCAAAAACACAAATGTTGCTTGAATAGTGATGTGACCCAATGTGGAGGGAGTAAAACCTTTAACCTCGTGAAT
GTTGCACGAAGGTGGTGGTGGTGGTGCGGTTCCCATGGAACCTNNNNNNNNNNGACGGGCGGAGATCCAAACGCGATCGCGGCAATTCCGACGGGAGGAG
CGAACGGCGCGGGCGGCGGCGTTTCGCTTGTGTAGATCTATTGATCTCCAGGCACCATGAGCGTGGTCGCACACAAGCACTACTTGGCGGACAAGAAGCC
GTTCTATAAGCACTTTCAGCCGCGCGATGTGTCGATCACGGCGTTGCGGTCGGTCGCGATCCAGGGGCTCATGGTGCTCAACGGCTTTGTGGCGTCGCTA
GATCTCGAAGAAAGCGACGACGAGGACTCCTCGACCGAAGATGACGATGATGAAGTTGGTCTCATCAAGCTCGCGAAGAAATCGTCCAAGAAGAGCGAGA
AGAAGGAAGAGTTTGTGCCGCCGTCAGCCAACGAATTTGGGCTCAAATGCTTGACGTCGTTTCTCAAGTCGCTGAGCATCACGACCTGCATACGCTCGCT
CGAGGAGGTCGCGATCCAGTACTTGCGTCCGCAGATCGTGGGCAAGCTCGTCAAGGGTGCGTACCCCACATGGCTACATTGAGACGACTTGGTGGGGGCG
AGATAAAACTGATATGTTGGTGATTGCTCAGACCTGAGCAAGTCGGCGACACGCAAGTATGTGCGCACGCACAGCCGTATCTCGGCAGCTTTCCTCATGG
TCCAGACGGGCATGCGCGGCAATGTGCTTGGCCACATCTCAATCTTCCTTGTCGAAGAGGTACGACACAAACCGCTGTTCGAGATCTCGGTATCAGCATA
AGTCAAGAGCTCACCTCCCTTCAATATGACAGGCGCACCAAGTGATCCTCATCCTCTACCGAAGGTACAAGACGACGTCCGGCACCAAGCAGTTGCGAGA
CGCCGACGGCAAGAAAAAGAAGCTGGAGGGCGAGAAGGAGGAGGAAGTCGAGCAGCCGCCAAGCTTCCTCGCACTCACGACCAAGAATATGTATCGCTCC
AGTCTCGCCGTGGTCACGGGCGGTCTGGGTGCGGCTGTGGGCACGTTTATTCGTCCTGGACTGGGGACTGTCATTGGCGCGACGTTGGGCGATACGATCG
GGTACATGCTCTAAAACCCCACGGGCCTTTCGTGGATCTCCCAATTCAACCTCATCGTGTTTAGAGAAGAGTGCTGAATCGCCGTTTCAGTCCATAGTAT
GATGGTGGAAACCTGAGAACTTTCACAGCGGNNNNNNNNNNGCCCCACGTGCCTGTCGTGGACTCTCCAAAACCAACCTCATCGTGCTTAGAGAAGAATG
ATGTATCGCCGTTTCAGTCCATAATGTGCTGGTGGTAACCTGAGAACTTTCACAGCGGCAAAGACGCCATGCGCGATCGCATGTTGATTTGAACTCGTAG
CGACAAGCACCTGCATTCTGCAAGTGGCGACACGTGACCTGCCAGGCCATGCCAGCGCATGCAAGTAATTTACCTCCCTCCCTTTATTGTTCGATAGAAC
CCTCTCATATGTGGTAAAACCTCCTATAGTCAGTACATCAAGACTAGTGCAAATCACAAAATTGGACGTTCTGCCTTGTTAGATGCCAGCCAAGTATTCG
GTAACACAGGTTTACGGAGGTTCCGAAAGTAACTTTGTCGCAAATTTTCCTGGGAGAGTCATCTCCAACACTCTTCGACCGAGCTGGCCCCTCCCGCAAC
CTTGCGAGACATCATCACACAGGGTCAAGAGCCCGTCGCTATCTCGACGAGTCTCTCTCCTGGCCGGCGCTGCGTCCTCCTGCGTGACCCGACACTCATA
CCAGACCACTAGAGGAGCCGTCCGAGGTCTCCCCTTCTCTAGGCATCGAACGGTATCGCTCGAACGATGACCATGATGGCGGCCGGCACGAGCGACAACA
TGTACGACTTGGAGACAGTCTCGCTGAACGACGACGACCAGAAACCCGTGTCGATCGATATCATCGAGTCCCAGCGGCCTGCGTACGCAAACGGCAAGGC
GGGGGCGAAAGACGTGAACAAGAGCCACGGCGATAGCGAACACCCCAATGGGCGCGGGGACGAAGACGAGCAAGCCGTAGTCGTGGTCGTCGACAAGCCG
CGGCCCGTGCCACCAACGCTGCCACCGCTCCGCGTCATGGACCTGTCAAGGCAGTTTGGCCCGGACGGCGATGACGGCGACGGCGACTATGTGGACACGA
CGCTCTTCTCCCCCGAAGTATCCCGTCAAGCGATGGACCAAGCGAACCGCCGCGCGCGGACACTCGAGAACGAACTGAAAGAACTCTCCGCTCTGGACCA
CGTCACGAGCGCAGCGAGCAGCAGCGGAAGTCCCGTCAAGATCACGCCGCAAGAAGCTGTGACGATTATCTCGTCTGCCTTTGTGACGTCGCTTGCCAAG
GCCAAGGCCCTCGTGACGGGCCAAGACGCCGAGTACGATCTGCTCGGTGGGTCGTCGCCGCAAAATAAAATGGACGATCTCGATACGGACGGCGATGGGC
TCCAGCTGAGTCCGGACGCGTCCAAGGGCGACGGAAAGCATTTCCAGTCGCCGCGCATCAAGCCGGCGCTCAAGCGGATCTCGGCGTACTCGGCCATTGA
GAAAGAGATCAAGGTGCCGCAGCCAAACAAGCCGCGCCGTACGATCGCGTGGCATGACGATGTGCTGGACCAAGACGAAGAGTTTGTGGACGATGGCAAT
GACGAAGACGATGAAGAGTCGGAAATGCTCATGGTGAATGGCGGCAAACCCGGCAACAGCGCAATAGCGAACCGACAAGCCACGCCGCGCAGCAAGAAGA
AGCGAAAGAAGTTGGTGCGCAGCATGATGCGACGGCTCACGCCCCGCGAAAAGGAAGAGCTCTATCGGCAGCGTCCGGATCTCATGATCGTGCCGAACTG
GGCGCAAAAGTACCGCGAAGAAATGACCGAGGCCGAGTCGTCGCGCTGGAGCTTTTGGCTCATTTCCATCATTGGCACGCTCGTCGTGCTGCTCGTGATT
TTGATAATGCTCATCGCTCGGGACAAGGCCGGAGAAGTCAAGAAATAAGGAACCGCGCGTTCTCACTCGCGCAGACGTCGTCGGTCGCGGCATCCGCTCG
AGATTGTGACCCAAGGTAGCTAGCTGTTCCTTTTGCTTTCTTAGCTCTCTCTTCCCCCGTGGCTACTGGCATAGTGTGGCAGCGGAGGGTTGCGTTTTTG
GTATCTAATGGACAAGTACATCGTCCCCCCTATCCAATACAAGCTTCCATTTTGCTCATTGGGGAAAGTGAGAGAGAGGAAGATGAAGCGCAAGCACTCA
GAACAAATGATAAAAAAAACGTCATTCTTGGAGGACGACGTTATCAGCGCCGATTGCACGACCAGATCTGCTCGGCCATACGCGCATTGCTGCCTCGACC
ACCACGTTTACTC