Description :
From Genome Similarity Track
Location :
Scaffold_4:1589155- 1597719
Transcript NameFunction/comments
Phyin_T30-4PITG_03396Putative uncharacterized protein
Phyin_T30-4PITG_03397Putative uncharacterized protein
Phyin_T30-4PITG_03398Histidyl-tRNA synthetase%2C putative
Phyin_T30-4PITG_03399Histidyl-tRNA synthetase%2C putative
Phyin_T30-4PITG_03400Crinkler (CRN) family protein%2C putative

Sequence
8564 bases(100 bases per row)
CCATTCGTCGACCAGGTGGCTCCATAAGTTGACTCTTTCGGTGCTGGTAAGACCAGTTTTCGAGGTTTGAGAAGCCTCTGGTCGTACAGATGCCATCCCC
TTCGTCCGCCGCCACCATGCCAGTAATGAGTAACACCTCCGCTGAGCCAGAGGCCAGTTTGGACGTCGTAAAAAACTGCAGAAGTAAAAACGACGAATTG
TCGACTGGTGCGAGTACCTCAACGCAGGAAGAAGCTGAAACGGCGTGCGGAGACGAGCAAGATCGTGTCTCAATTCAGAGCGACGATCGGATCGAATCCG
AGATCGAGCCAGAAGAAGTGGTTGAAAAAGTGAGCGAGGAGACGGCAATCTTGAAGTCGACGACTGCAGAGGAGAAGACGAAGGAGGTTATTGACACTGA
AGAAAACGAATTGAAGCCCGCAGCTACCAAGACGCAGAACGAACCCGCGCTGGAAACGTCCAGTGACGACTTGTGGAAAGAAGAGCAGAAGGAGAAGAAA
CCACCGCTGCCTACACGTCCTGCAACTGCGAGAAGTGCCGAGTCGAGTTCTGTCACTCGCCGTCCATTTGTACCGCTGGCATCAAAGAGTTGGCGCGTGC
GAGCTATGCAGTCCAACACGCACCTCACGCGTTTAATGAAGGCAGCGTTGCTGCAGACGCTGCTACACGCTATCCGCACTGGATCGGTTGAAGGCGTGAA
GGTTGCAATTGAGCGTGGAGTGCAAGTTCAGTACCTGGACAGTCGCCAGCGCAATCTCGTCATGCTTGCCACCAAGTGCGACACCGACTCTCGGCTACGC
ATTGTTATAATTCTGCTAGACGCTGGCTGTGATATGAACCACAAGGACCAGCTAGGTTGGAGCTGTCTGCATTACGCTTGGTACGTGCAAACACGTAGAA
GAAAAGCGGGCGTCTGTGTGCTGTAGACTAACTATGTTTATTCGTTCTATTCCAGTGCCAGTGGAGCGGACGATGTCGCTGCAGAGCTCATTCGTCGTGG
CGCCAGTGTCGAGTTTAACCCCTATGGATACGGCCCAGAAGACTTCAACATTCCTAAGGTGGCACGTGCAAAAAGTCTGTTGCAACACACGGAGCAGCTG
CAACACGAGCAAAATGTGTGTTCTGCGTGGATGTATTTCCGCCGTCAAGCTGAAAAGTCTGGCTACAGTGTCAAGTGCAAATCGGTATGTACACATTCAG
TTCCTTGCTAAAGTTTCCACAAATGACAGGACTAAATAATGTGTGTGTTCATGTTTGGTAGAACTGCGATCTTGGCAAGCCTCTCAAGATTACATTTCAA
GCTCCTGCTGGGCACAGCCCCCTCGACCGTATCCGCGTTGTTGATATGAACTCGGATGTGGCGCTGTGGCTTCAAGTGTCGAAGACCTTTAATATTCCTC
CTGGTGACGTGGGCACGATCACGTTGGACGTGGAGACGCTGGACCGTCCGTCCTTGTATCGTATTGTTTACGAGAAATATGAGCCGACGCCTATCCAGCT
ACCGGCCTCAGTTGCTGAAAGCAGTTTGTGTGTCAAGAATCTGGACACGGGGACTACAGTGTCTATGGGAAGCGTTAATAATCTGGTGCTTAAGGAACTC
AAAAGCTCGCGAACAGCGAATAAAACCAAGAATTTGACCAGCTCAGCCAGGTGAGTCGCAAGCCACGTTCATGCGTTGAGTATGGCATACTGAACTGTTA
TCTTTGCAGACCAGCACCTAAATCGGACAAGGCGACGAATGCTTTGCGAAGAGGATCCACAACGTACGTCTCAGTGTAGAATGTGGTGTAACATTATACT
GGAATTGCTGTGCTAATACTCGGGATATGATTACAGTCGGGCGCGGGAGATCACAGAAATTGTGCATGAAGCCATGGTGGAGGAGGAGGAAGAAGGAGAA
GAGGCCGAGTTCTCAGCTGATGAGACAATTACGACCCAGGAAGTGGCCGAGCACCCTGCGGTCACGAGTATTACTGGCGTATACAAGATCGTGGCAATGG
GAGTTGTCAGTGTTTCGACGCTGAGAACTGCCAAGGCGAACGAATATGAAATCACCATCCGTGGCAAGGGTCCTCTTGGTCTACAACTGGTACGCTTTCA
GCCTTTCTCGATGCCTATAAAACAGTATTCACGTCTAACACCGGATTTTAATGTATAGGCACCCAAGATTGAAAGCTTGAAGAGATCTCCACGTCTTATT
GTACGTCGCAGTCAAGGCCAAGCAGCAGCTGTGAATCCGGGTGATTGCCTCGTTGCGATTAGCAACGCTAACATCGAGCATGCTGGTCTTAAGCACACGC
TGTGGGCTCTGAACGATGCAAAGCGCCCCCTTGTGCTGCGCTTCCGACGTGGTAATGCCAAGGAGAAGAGAAGTCTGTTCAAGGCTGGACTATCCAAGAT
CACAGGACCCCGTAGACAACCTGTCATTGCGGTGTAGTCTTGCAGCTCTAAAAGGTGCAGTTTTTTTTAAGTTTTTTAGGATGATTAGGCAAGTTTTATG
AGGTCTATACATGAAGCCATGAATGGATTGAGTTTCTGGAGCTTAGTGTGCAAAGTGATCTTGTCCTGCGTATTCTCTTACTCTTGTACATTTAGCTGAC
AGGTCACCATGAGCCAGCGACTACAACATTGGATGGCCTTTGTCTACGTGGCAGTACTTGAACGTCCTGTTCTGACCAGCGCATCGTCGACATAACGACC
CAGGCTGGGATGACACGTCAATAACGTGCAGCGGGTGTGTCTGCATAAAAGACATCAGTCAGTCTCGTCCCAGTTTCGTTACTGTTCGCCACATCAGCAA
GAAAACTCACTCTGAAGTGCTCCAGTAGATCATCTGGATGAACTTGTATGCGAGTTTCTGTCTCGGGGTCGTACACAGTTGCAGGGTCTGCCAGACGTTG
TACATGAGGAAAGCGTTAGGTGAAGTTCCAGTAAGCAAAACACCAGGGCTTTAGAGACTCACATTGTTTGCCATCACCGCACCAGACGTACCAAGCTTGC
GCCTCCCACCACGCTGGCTCCACCGAACCAGCATTCTGATACTGTTAGCGGTACAGACAGCATTAGTGTGAATCAATAAGCATCTTGCTCTTCTGTAGAA
GTAACATACTGCGATCGCTAGCATGGATCCTGGCCGTAACGAGTTCGCCCACGTCTTCACGTGCCCCACGAAATCTTTCGGGGCTTTATTCGCAGCGTAT
TTCTTCATCAGCAGCCACTCGCCGTCCTTTCCGTTGCCACGCCGCCGAACCCACGGGTTGTGACCGTGAAAGGACCATGTATTTGGTAGTATGATTCGGT
GTGGCTCGTTCGGATCCACGTGGACAATACCAAAAGACCAGAGTGGGAACTGCTGCCTCATCGGACCCGTTTTGTAGCCAGTGTAGTAGACGAACAGTTT
GTGCACACAAGTCATTTGGTTGTGCATGAACTGTGACCATGATTCCATCCCCTTGGGCTTCTCTTGTTTGAGTAGATTATCCCGAGGTGTCTCGGCCAGG
AACGCTCCGGTGGCTTGCTTGGCCATAATGTCTACGTCCCGCTTAAGCGTTTTGTTGGTCTGTCAGTAGGCCACACCACACGTCAGCAACGCATTGCATT
CCGTCTCTTCACACTTGCACGCACCATTCCAAGTCTTCCCAGCGAAATAGGCGCCAGGAACCCTGCAATATATAGCTTGAGCTCATAGTTAAATTGCTGA
ATATTGGCCACTTTCTGGTACGCGTGCGTTTTTGTCTTTGTTGCTACTGGCACGGTGGCGCTGTCTCCGTGGCGCTTCTTGGCTGCGGCTCTCTCAGTCA
GGTTCTTCTGGAAATAGGCGCTCTCCACGCGCAACATACATGAACAGACGTCGCGTCCGTTGCAGCGTCGAGTGTGACGCACGAGTTTGGCGTCAATGAC
AGATGTGACAGCATCCTCGGCTGGCATCGCTTCCTGTAGCTGCGGTTCCGAGCTCATGGTCGGTTTGCTATGGGTTCCAGCCAGCAAATGAGCCTGCGTC
ATTTGATTCGCTAAAATTCGTATGAATATTGAATGATTTCACTACAAGTACTAGTATGACACACTTTTGCATTTTATCATACCAGGGCGTGAGGCTGACG
GATGCGGGGTCTGGCGCTGTGGCGAGCGGGTTCTGCACAGGCGAGCCAGATGCGTCGGTACCTGTCGGTTGCTGCTAAAGCGAAAGCCGTCAGTCGTGTG
AGAGGCACAAGGGACTTGTTGGTCGACGACACGCAGCAACACCGTGAAGTGTTGGATGTGCTGAAGTGCACTGTCGACCGCTATGGGTTTCGGGCAGTGA
GTGTGAACAAGGATGCATTGTATGATCTGAATAGTGCGTGTAGGACTGACAACCGAGTTTTTGCAGATCCAGACGCCGCTGTTGGAGTACACTGACCTGT
TTTCGCGTTCGTTGGGTGACGGATCCGATATCGTAATGAAGGTGCGTCGAGATGCTTGATCAAAGGTGGAGAATGGAACCAATAAACTGGTCACTTGCAG
GAGATGTATACGTTTAAGGACAACTCGGGCAAAAGCGTGACGCTGAGACCGGAAGGCACTGCTGGTAAGTGCTCGAACTGTAGCAATTGGTTCAAGGATC
ACAGCTAACTGCGTGGATGGGCTCCTACAGGTATCATGCGGGCGCTTGTGAGCAATAACTTAATGTTCTCACTGCCCCACAAAGTCTCGTATTCCGGTAG
CATGTTCCGGTGCGTGTAGACTGCCGTATTATCTCCAGTTTAGTTGCTAGTGCGAGTGTGTTCTTAAATTAACTGCTCTTTTGACGCAGATACGAGCGTC
CTCAACGCGGAAGATACAGGGAGTTTCAACAGTTTGGTAAGTTTGCTGTAGACATGACAGCGCGCTTGGAACTGTAGCCTAATGTGATGCATTGTTGTGT
TAGGCGTGGAATTCGTTGGTTCCACGGGGCCATCCGTTGACACAGAGGTGTTATTTTTCTTTAAGAACGGTCTACCTACAGTTTTATGGACTTATGCGAA
CCGTCTTTGATAATTGCAGGTTATTGCTATGGCTGCTGATGCTTTGGATGCTCTGGGGATCAAACACAAAGTTGTCCTAGAGTTGAACTCCTTAGGCGAC
GGTGAGAGGTAGCTATACATTATCTCGTAGCGGCTTATGCATGTGAAGAGCGTGCTGACCCGTTCTATCGAATTAGTCGCGCAAGGTACCGATTCGCACT
GGAAGCCTTCTTCTCAAAATTCAGGGACGAACTCTCATCCGACAGCATCAACCGGTTCGTTGGCATTTTTACAACTTGTATCTGCAATGTTATGACCGTC
GGCTCCTTTCGCAATTCTACTGTAAGTCTTGAGCGAGGAAGTGTTCTTCGAATCCTGGACTCGAAGAGTGAGATCGACCAGAAGATTATTGCTGATGCAC
CACAACTAAGTGCCTTTCTCTCTGAGGACTCCAAAACGGTAGGAAGAACATCCTTATTGCTTCCTGACAACGAGTGATGCTCATCGTATTTTGCTTTAAG
CGCTTTGACGATGTCTTGAGTGGCTTGGACGCTTTGGGCATCACTTATCGGCACAATCCACGCCTCGTGAGAGGACTGGTACGGCTTCTGCTTGTGTGCT
CAAGATACAAAACGTATAGGAACTCACTCGTGTCACATGATCGGCCCGATTGCAGGATTATTACAGCAATACGGTGTTCGAATTCGTTGAAAAGCCTGAC
GCAGAGCAAGCAACTGGTGGTGGTATTGCGGTCCTAGCTGGCGGCTGCTACGATGGACTGGCGGAGTCATTAGGAGGACCAGCGACGGCTTGTGTGGGCT
GGGCTGCTGGAGTTGATCGACTGAACCTTCTCCGTGACAAACCGACCAAGGCAATGTGCTCCGTTGCGGTACGATTCACACGTAGCGTAGAAAATGATCA
CACTGTTGTATCTAACGTTTTTTATGCGTTAGATCGTCCCTGTGCTCGCTGGCGATACTTCGAAACATGTGCTTCACGAAGCTATGCGTGTCGCGCAGGT
ACGATGTGGTTGACGGCGCGAGTTAAATGTTTCCTGATCGCACTATTGGCGCCGTTTTTTTTTTCCTTAGACGCTTCGTCAGCGTGGTCTGACAGTTCAC
TTCTGTCATGGGAAGGGCAATATGAAAAAGCAAATGAAGGTGATGTTGATACGCTTCCGATACGGAACATTTGCAGACATATTGCTAACGTAATTTTTCT
TGTGTTAGGCTGCTGAGCGCTACGGTAGCACTCACGCTGTGATCCTGGGTGGAGCAGAAGTGGAGCAGCAAATCGTAAAGGTGAAGAACCTCGACAAGCG
TGAGGAGGTTGAAGTGACAATGGAGGAACTGAGCAGCTTTGTGCTCTATTGAACTTGCGACGTCAATGGCACGTGCACAAGCCAACGTTAGAAAACATCA
ATAGACGGCGATGTATCCATTTGATGACTTCAACTTGTAGCAGGTCACATTAGAAAAACCTTGACAACTGAGGTTTTTCGCACTACCATCTCAAAAATAC
GCAAATGATTTTTGGGTGCTGAGCATGGAGGAGGAGGAGCAGGAGCTACACGAGCAGGAATGCGAGCAGGAGCCGGAACCACAAGAGCTGGAACTGTGGT
GCTTGATCGTTGGAATGGTCGGTACGGCGTTTCCCGTCGCTGTAAAGGGAACTGACCGTGTCTGGGAGCTGCAAAAGACGATTAAAAACGAAGCTGTGGA
GATCTACGGAGACTTGAACGCCGCCCAGCTGAGAGTATATCTGGCCAAGAACGATAACGGCGAGTGGCTTACTACAACTGAAGTAAAGCGAATTGAGAAC
GGAGACACAAAAGCGGCCCAGATTTTGCTGGAGAGAGGTCACTTGGCGTCCATGAGCCAATTGGCTAGGATCTTCAAGGACCGTGCCGTTGACGTCGTTC
ACATTCTTGTCCAGGCACCTCTTAAGGCCCCAGAGATAGAGATGCAAGCAGACATCACAGGAAAGAGGAAGCGATCAGAGCAATCGATTGGAAACGCTGA
GACAATTGATGTTTCGGCCGACGAATTGAGTCTCCTCTTTGACGTATTGGGGCAAAACAAACAGACTGAGCAGAATTTGGTTGCAACTGCTGATCTGAAT
AAGTTTTGGAAAGAGTATGGAGGATTTCCGTCGACATTTTTTGTGCGGAAGGAGGGGCTCATCCTTTGGAACCTGGTTTTGCGGATGATGTCCAAGAGGG
ACAAGCGGGTCACGATCGTGGGCTCAGCTGGGGTTGGCAAGTCGTGCTTCCTCGCATTAGTCGGATTTTACTTATCAGTTGTTGAAAAGCGGAAGGTTCT
GATTGTTCGCCGGTTGAATCGTTCATCGGAAGCTAATGCTGTGGTCTATCTTGATGGCGAGAGCAATTCTTGCATCAAAAAGACTAACTTGACGGCTGCG
AAGATTTCATTGATACCTGACAGGAAGGAGTCCCAAGGTGCGTTGATTCTTGTTGATGGCTACTCCCGAATGGAAGTTGAACATCGGTTTGGTCTCTTTC
CGTATCAACTGCTGGCGTCGTTCATGGAGGACGAGTTTTCGACTGATGAAGTTGTGCTGCCGGCGTGGCAGTTTAATGATTTGTTGCGTTACGCTGAATT
GACACTACCGACTTGGAAGAGATTAACTGGCCTGGATCAAGAGAAGCAAGAAACTACGCTGAAACTTGCCCAGGAGCAATACTTTTACAGCGGCGGAAGT
CTCCGCGACTTTTGTAGAAATCGCGTCGATGTCAAGAATGGAATAGATGGAGTATGTGCTCGTGTGAGCAGTGCACAGACACTTGACTTGGAGCTTCAGT
TAGGCTCCCGAGGATACAATTTGTGGGATCGAATTCGGCGGGACTACGTCGTAGATCCCAACGATGACGAACATTACTGGCAGGTTTGCCATCGGAAGAC
CGCGATGGATTCTGGATATGCATTTAAGCGGATAGGGCGCTTTATGGACATACAGAAGCAGATTGACCTCTACAAGATCGCTCAAACGCTCCAAGCTGGA
TTTGAGGGCTCGGCATTTGAACAGTGCTTCCACAGCGCTGTAAGGCGGTCTACAAAGAAATTTCCTGTTCAGATGGTAAATGTCGTGGTTAACTCTGACC
CAGCGTACTCAAATCAAAGATACGATCGACTCGTATTGCACGGCCGGCCGGTGGTATGCCACGGTAGCACAGAACAGGATTGCTTCGACAATTTGTCGCG
GCTATGTTTTGGAGCCTTTTGTCATCTTGATAGTGTGAACTTCCCGTTCGTCGAGGCCGTAGCAATTTGCGAAGGGGTTTTGAGAGGGAGCAACGTTAAA
GAAACAGTTGTGGCCACGATCAGCACTACTGTCTCCAAAAAGAAATCTTTCAAGTCGGAGCTCTGGACCAAGCTAAACAAGGCACTTGATCGCAACAAGC
ACATCTCCGGCAATACTCCACGCGTATTTGCAGTGGTTGGCCCTAATGCCAGCACGTGCAAGAGCTTTACCTTGATCGATGCTCCCGATCCAAAAGACTT
TATGGTGTGTTGCTATGACCCACTGAAGTTGTATCGGAAGTCTTCAAACGCAACAATTGCATGA