Description :
From Genome Similarity Track
Location :
Scaffold_553:1589- 4634
Sequence
3045 bases(100 bases per row)
CTTCTGCAACTTCGGACCTCAAAGAGTTCAATGGTCGATACCTAGACAAGGACGGGGCACGCAGTTGGGTGACGACAGTGAAGACGGCCTTCGCAAGGGC
CTAAGCACCGGAAAGCGAAAAGTGTCTTGTCTTTGAAGGGCTGCTGATCGGACCGGCGCAGAACTGGTATCGTCATTGGGCCGCTTCGTTAGAGAATATT
GGAAGGACTTGCTACAAGAAATCCAGATGCAGTTCTGTGGCCTGTGGGTACCAGTTGCCCGCCAGCACTACCACGCGAAGAAGAGGTCAGACGAATCCCC
GTATGACTACCGATACCGCCTGAACGTGGTTGCTCGCAGGGAGAAGATGGAGATCAAGAATGTATCACCCAAGATCCAGAAGGAACATATCGAGCATTAC
ATCGAGACCGTGGACGACCTAGAGTTGCCAAAAAAACTGACGATGCTACGTCTGTCAGAATGGAAGAGCTGAAGGAAGTATTGAAGGCGCACCACAAGTC
GAAGACACGGCGTGGCAAGACGCTTTTTGATTCCAGCAAGTTCTGGTAGAAGGTGTCAGCTCCTCCGGATCGACCTAGATATATAAACCGCCGTTCTGCA
TGTGGTCCAAGCAACCCTAGAAAAGTCGAGTTCGGAGAGATCCAGCCTGGATAATTCGGATAGCGAGGGAGGCCGGAGGTGAATTTTTTTTAGCGGAAGC
GGAAAGAAACCAAAATACAAGGACCATGAGATACCAAGCCACCAGAGAGGTCGACCAGCATCGGAAACAAGTGGAATACCCTGGAATCCGCAATAGGTCG
GCCAAATTAAACGTAAGATGTACCCACTGTGGTCCAGGAAACATGGAGACTTGAGGTGCTGGAAGAGAATGACCTGTGACCACTAGGGGAAGAAGGGGCA
CCCATCAGATCGCTGCTTGCTCGTGTGTCGGGGATGTGGAGAGACCCATGTAGTGGGGAAGTGCCAGCTAAAGGACTTCTACAAATTGATTCTATAATAG
TACAGCCCCACCAAGCACGACGGAATGTTGCCGGGGAAAGTTGAGAAGATGATAAATTGGAATACTCCAGGTTTGAATCTGGTACGAGTCGACCGTTCTA
GTTTTTGTGTCTTTGCATATTTGGAAAGCAGCCAAAAAGGGGAGAGGGGGTTTACCACTGAGAAGACCGAAAATATATCGAAGATTGGAAACTATCCCAT
GGACCATGTTGTCTCTCTCACTGAACCTATGATTTCGATCAAGAAAATGCAGTGACGGAGTTAGAACTACTACCTGGCGATTTCAGAGGGTACCGTGCCC
CCACTATGTTATATAAACAAGCCAAACTCTCTGTGAAGACTATCAACGATCGCGCAATTTTTTGTTTAATACTGGCGCCGTGATATCCATTTTAAATGTC
GCCTGTGCTCGTAAGGTAGGCTGCCAAATTGACAAAAGCGAAGGGCAAAATTGCATTGGCTTTGGGGAATCGGTGTACTCTACGTAAGGGCACCGTCGCA
TCAAGGTCACCCTAAGCGTCAATTTAGTGTACATTATCAAGGTGTGGATAGGCCCTATGGTGGGTCAGGATGAGATCTTAGGAATGGACTTCATGGTACC
GGCTGGTATCCCGATAGATCTGGCGGATGGAACACTTTGTCTCCCTGACGAAGTCCGAACATAACTCTCCGGACAGAGGGCCGTTTATGATAACCGAGTC
CCAGACGTGAAGTTAGGACAATATGCCCGTATACTTGCTGGTGGATGTGTGGAGATACCTCTTGAAAAGTCGATATCAGATCAATGGAAGATATGGTTCA
CAAGGGGAGAGCGATTGATTACAACTATGATCCAGAGAACAGGACGCTGACAATTACTATATGTGACCAACGTCAGCCCCACACGTTGATATTACATAAT
GATACCATGATAGGTATGTGGCTTACGAAGGGTCAAGTACCAAGAGCACAAGGGTTCGTCTATAGGCTCTCGAAGGTACGCTGAGTGGCGAATCTGGCGT
ACGAAGCCCCCACCGACCAGGTCGACCCCAAGTTGACCTCGAGTAGGAAGACGAGGCACCACTAGTGGAGACCCCGAAGTACAAGATCCCGTTGCATAGT
TTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGCATCACTAGTGAAG
ACATCGATGTTCAAGAGACCTATGCATAGTTTGCAGCGTTAGAAGCCGGCAGGATCAGTGAGGACTCTGTCATATCAGCCGATATCAGAGAGAAATTAGA
CATTCACGTGGAGAAGAGATGCCTCAACGAGAAGAAACAGCTCAGAGAAAGAAGTGGTCCCAAAGTCAATCCACCGGTAGAGGTTGTACTAGAAGAAGAG
GAAGCCGAGGCCAAGGTATTGCCACGGGACGATGAATAAGTGTGTACATTCCATAGTGGAGCCCTGAGGGCCAAAGACATAAACCGAGGGTGGACAATCA
TACCGGAAGTGGACCTCCTCTGAAACTATCCGGTTAAAAGCCATACAGATTCCTGATCCGGATGGGAACACTCCAGAAGAGGTAGACCGGCTACGACAAA
TCATCTGGAAAAGACGACATCTGTTGATGGGGAAAGGGAAAGCCTAACCGCCAGCCGCTCGAGGGGCTATATGTGACAATGATGTAGTAAATGTAAAGCG
GATCGCGCAACGTGTACGGAAAGTGGCCCCTCAATTTTAAGAGCAGTTGAACGACCTGATCAAGGAGCTGCTATCTGTTAAATGTTAGCGGAGCGTAAAA
GTGAAGGACACTTGTTGGTCGAAGCAGCAAAACCAAAAGTGCATTATGTTATAAGTGGAAACTCGTTCCTACCGTTTCTACTCATCTTTCCAGGTCCATT
CTTCATTCCAACGTCCCATCAATCCAGAAGCTCCTTTCCCATGTT