Description :
From Genome Similarity Track
Location :
Scaffold_2155:1589- 3141
Transcript NameFunction/comments
Phyag_g12125conserved hypothetical protein

Sequence
1552 bases(100 bases per row)
GCCCCGTTCCCCGTCAATCCACAGATCAACGCCAAGATCGCGCTCTGGCGTGGCCCTCTCCACCGGCTGCGCGTCGACGCTGTGGTCCACTCGACGTGCG
AGACCATGCgcgagagcgacggcgacttcgccaagctgctgaaggccGCAGGGCCCGAGATCCGTGTCGAGTGCGACGCCGTCGGCGCTTGTCGCACGGG
GGACGCCGTATTGACGCGAGGGTGCCAGTTGCCAGCCAAGTTCATACTGCACACGGTGGGGCCGCGCTATCTGCCCAAGTACCACACGGCAGCGGAACAC
GCGCTGCACTCGTGCTATCGTAGTGTGTTGGCAGTAGCCAAAGAGAACGGACTGCGCTCCGTGGCGGTTGGATGCATCTACATACAACGCAAAGGGTACC
CCAGAGAGGAGGCGGCGCATATTGCGGCGAGAACGGTGCGACGATATCTGGAGCACTACATCGACAACTTTGATCGAATTATTCTAGGCGTGGACTCGAT
CCAAGACATGTTCGTGTACGAGAGGGTATTGCCGCTCTACTTTCCCAGGACGAGGAGTGAACAACACGAATCGCAGCtgatgctggaggcgcgAGATCTT
GGTTCGTAACCGGTCTTGATGAAAACAATGCATCATCGTTGGCACTGAGTTTCTAACTGCTGGACTTGCTTCCAGGCGACAGCTTCGGTGAGCCGATCAT
CGCTGAGCGCAAGATCCGAATTGGCGATCTCAGTCATAGCACTACTTTGGTTGCCCCtgagcactgcaacaaccaTCACGAGTTCGAAAACAAAGATAAC
AATAaccagcggcaagaaggttATGACCTGTCCGTCGAAGATGCTGTAGTGCCTCAAAATGAAGAAGCGGAGAGTGATATCAAAGCGTTTCGGGCGATGT
TATCTGACCCAGACGCAGGGCGCTTAGctcggctgcagctgatgcagGAGGAACGCCAGCGTCGAGCGGCGGAGGCTGCAGTTGAGGAGCAGAAAAAGCT
CCAAAAAGCTACGGCTAGCGCAGCTGACTGGGACTACGCTGCCGCGCTTGAACGTGCGAGGAAGGAGGATTTCTCAGACCTGAAGGCTCTCGGGTTCTGC
TACAGTGGTGGAGTCGACCTGGCTGGGTTTCCTGTGGTCGTCTATCTTGCTGGAAAGCTGCGAATCGAAGATGTTGACCTCGAGCGGGTGCTTCTATTCG
TGCTGTTAACGCTCGACTCGCAACGTACAGCTCTGACTGCAACTAGCCCACAGTTTAGTGTTCTCTACGTGCACTCGGACGTAGCAGATGACAGCCAACC
GCCTACATCCTGGCTCAAGCGACTATTTCGTGTGTTCAGTGGGGTGGCAGCACACCGAGCTCCGAACGAAGAAGCGGTCTCGGCCCTTCGCTTCTTCTAC
GTGTTGAAGCCGTCCTATGGATTCAAGTTCCAGTTGTACTGCGATGGAGGCGGCTTCTACAATCAGGTGGTGTATTTACATCGCACAGAGATATTAGACA
GCATCGCGCCTACTCTGCAGCTGCCACCGCACATTTACTCGTACGTGTGAGT