Description :
From Genome Similarity Track
Location :
Scaffold_39:15887- 17051
Transcript NameFunction/comments
Physo_135515hypothetical protein

Sequence
1164 bases(100 bases per row)
GCTGGCGGAGTCGAACCAGGAGAGGGTTGGAACCGGTGGCTTCTTGTTCGAGTCCCACCCGCTGAGAACACGTGCTACTTTCTGGTCTTCAATGGTTGTG
TTGAACACGTAAGCGAAAGCCTTGTTGGTAGCCGTCATGTTCCACGAACCACGATCGAAAATCCACTGAGCACTGAGCAGTGGATCACCGTTTGCATGCT
GAGCCCCACCACGTCGAAACGAGTGAGACGTCAAGTTTGCAGTTGGCACCGCTTTAGCTTGAGCGGCAGACGCTGTCTTGATAACGCGGTTCACGTAGGC
GTGGATCTTCATGTTTTTTTCAGGCAATTTACGCTTTTTCTGAGGCGGCTCACTTGGCGTGTCGTCATTCTCACAGGCAACAAGAGCTTCAGCTAGTGGC
ACGTCAACAGGGGCTGTCATACTCTCGTCGCCGCTTGCGGCAAGGTGCGGAGGATCCAGCAGCTGTGCGCACGGAGCGTCCTGCATCACCAGGGCCATCG
CAATCGCATGCAGGGGGCACGTGATGAAGCTGTTCTTGTCGAGAAAGAGAGAGATGCCCTGCTCGTCTGAAGTCTTCACGCGGATGAGCCGGACGAACAC
AACGCCATCCGCATTCACAGACAGGTTTCCCTTCACCACGAACCCCAGGTCTGAGGCGCGGCCAAACGCGTACCACATCAGCGCCAGTAACGCGGCATCT
TGGTAGTCCTTGGGGCTGGCGGCATCATAGTAGAGTCCGTCCATGAGAATTCGTAGGTCTTCCTTCGTGCAGGCAGGCGCCTTCTTGACCATTCCACCTT
CGATGCGCTTCAGACAATGGCGCTCGAGCGTCTGTCCCATCTTGAGTAGTTTCTTCTCGATGGTGGCTCGGTGGGTCGGGTAGGTGTCGAGCAGCCAGTT
CTTTACATGGCGGTAGTAGCTCATGACCGAGTTCTTGGCCAGCGGCTTCCCTCCTCGGCCTTCGACGAAGGCGAGGTGAACGCCATAGCGGTCCATGAGC
TTCACAAACACAGCCCCACTCTCATCATCTGCGAGAGAGGCAGCGATGAAGTCCATGGAGACGCCTTGGGCCATGACGAAGCGTCCGAAGGCGTTGATTG
CGGTTTGTAGAGCGCGCTGGGAGTTGACGGGGGCGAGGTCTTGGAGGCTCATACTGGTTCCGAG