Description :
From Genome Similarity Track
Location :
Scaffold_162:15883- 17378
Transcript NameFunction/comments
Albla_Nc14087840conserved hypothetical protein

Sequence
1495 bases(100 bases per row)
AGAGCAAAAAGACCTCCATCGTTGGAAGGTCATGACTGTACAGCTCCGGCCGGATCGTTCCTGGCCCATTATCCGAGACTTGATCACCACAGTCTGCATG
ACACGAGGGCTACTGGTATCCACCGAACACTCTTACAGTGTCACATACACTCGTCGAATGATAATAACCCCATTTTCTCACACAAACATGATGACCCAAG
GCCAAGGTCGGGTCCTTGCAGCCCAGACAGAGGAGAATATTGCAAGAAGAGAGCCACAAAATGGAACGATGATGATCCTATACGTACAAATAGGCGTCAG
CGCCTCGAAACTCCGCGTGTTGACACTTTGTACAACGGTTTACAACGAGAACAAATTCTTAAATACACTAACGGGAGCACTGAAGAATGAGGAAGCCATC
ACACGAGAATTACATCAAATTTTAGTGGATTTACAATCGCTTTTGATCAAGCAGTATCTCCCATTGACGAATTTGTTTATGAAGACACCGGAAAACACAA
CCGCCAACCATCTCGATGGTATAGAATCGTTGTTTCCGACGGGTTTTGGTCTCATTCTTCCCATAGAAATCGCACTGGATGAAGGATACACCGCCGATGT
ACGAAGAATGTATCAGAGGTACGCTCCGTGACCCACCTCGTGTCTCCATCCTCACTCAATATCTCGCTTTGGCAGTGAGATGAAGCAGCATTTACGAGAA
CTCTGCATCCCTTTGGAGGAGTACGCGTATGATCAAGAGTATGCCTGTGCCCTCCTTTTAGGTCTACTGGATCCGCTCTTGAAAAAGCACGCTATCGATC
TCCAAGCAGCTCTTGATCCCCCACACAACTCGCCTGAAAAGCAGAGGAATCCATCTCTCACGGAGGAACAAAATGACGACACAAATGTCCTCGAGCAATC
GACCGAATCGGACGATCCGATGTACGGGCAAATCATAAATCGCCAAGTGCACGAGCTCTGGCATCAATGTGAGCAAGAATGTAATGCGAGACTCAAGCAG
AAAATCTGCGAGAAGAAGCATCAGATTTCAGCCAAAGCGAATTCCGCCAAACGTCTTCGTCGCTATGCCATCGAATCCATCATCCAAAGGTGCGTCTCGC
ACTTGATCCATTGTGCCTCTGACATTCGTATAGCAATCAAGCGGAAGTGACAACTTTACGCCCTTGTCGTATTGGCGATCGGTACTGTATCACAATCCCT
CACTCTCTATTCTTACGATCTCTGTAGCTTGGATGTTCTCCTGTATGAGTGCACCTGCATGATCAACACCACACCTTCCAAGCTCCATGTGACCTATGGG
TACGCAGACCTCACCCATGGAGCCGCTCTGAAGTTGCTTTGTAGTGGGCTCATCTACCAAACGCTGATACCCTTCTTCTCCAAGACCGTCCACATTCCAA
TCACAAACGTGGAACAGGTCGCCAAGAGCCAAACACTGGGCATCCGCATGATCTCACTCCGTGAAGTCGGTCCTGAACGAAAAACAACGACCATC