Description :
From Genome Similarity Track
Location :
Scaffold_58:158827- 162565
Transcript NameFunction/comments
Phyci_312796ABC transporter lipid exporter ABCA1 family

Sequence
3738 bases(100 bases per row)
GACTGCGCAAGGTGTTCCAGGTCCCCGGAGGCGAAAAGGTGGCAGTCAAGGGGCTCGACGTCACCATGTACAAGGACCAGATCACCTGCTTGCTGGGCCA
CAACGGTGCCGGCAAGACCACACTGATCTCCATGCTCACTGGCATGACCGCTCCCTCCAGTGGTAACGCCACCTACCGCGGCATGTCGATCAACGAAGAC
ATGGACGAAATGCGTCAATCCCTCGGTATTTGTTTCCAGCACGACGTTCTGTTCCCGGAGCTGTCGGTCCAGGAGCACCTGCAGTTCTTCGGACAAATCA
AGGGCTACGCGAACGAGGAGCTGCAGGCTGTGGTCGATCGGCAGATCCGCGAGGTCGGCTTAACGGAGAAGCGCAACTCGAAGCCCAACGATCTGTCTGG
TGGCATGAAGCGCAAGTTGTCGGTGGCAGTGTCGCTGCTCGGTGACAGCTCGCTGGTGTTCCTGGACGAACCCACCTCTGGCATGGACCCGTACAGCCGT
CGCAGCACATGGGAGATCCTGCTGAACAACCGCAACGACCGCGTGATGGTTTTGACGACGCATTtcatggacgaagctgacatcctgggtgatcgcattg
ccatcatggctgaaggcgagatgcgctgctgcggctcgtcgctcttcctgaagaaccgcttcggcgcgggctacaacttgaccctcgtcaagGACGACGC
CAACTGCGACGACGAAGAGGTGTCGGCCTTTGCAACCTCGTACGTCCCCTCTGCACAACTCCTGAGCAACGTCGGAAGCGAGATTGCGTTCCAGCTTCCC
CTTCACAGCTCGGCGAGCTTTGCTTCTATGTTCGCTGCGATGGATCTTCAGTTGCAGACGCTGGGTTTGCTGTCGTATGGAGTGTCCGTGACTACTTTGG
AAGAAGTGTTCATCAAGGTGGCGGAGTTGGCAGACGAGAACAACCAGCATACGCTAGGCAATATTGCTCGAGCGAATTCTTCCGAGTCGGCAGGCAACTA
TCAGGCGTGTGACGAGTTGATCATGACTGAACCAGTCTTCAAGACCCACTTGCGCGCGTTGCTGCTGAAGCGATTCCGATACGCGAAGCGTGACAGGAAA
GCACTCATCTACATTGCAGCGCTGCCCGTTCTTCTTATCGCTGCTGGCTTGGGGATTCTTAAGGCCAGTATGGCGATCAAGGACGACCCTCTGAAAGCTC
TTACGACGGAGGCTTATTCCGGTAACGAGACTCCGACGCCGTACTTCTGCCAGGCTGGAGCTGGAACTGGGCAATGGTGCAGCGAGATGATGGCTTCGTC
ATATTACTCTGGAGCCAACGCACAGGCCCTTTCGATCTCGGAGCCGGCATTTGACACGGATTCGCCCACGGTATTCGACGTCATTTACACGGACCCGACC
ATCAATGCGAGCGGCGCGACCGGGTACAGTGTTGCGATGGGCCAGCAGGTTTACGAGCGTGGATATGGTAAGGGCGCTGGTCTTGTAGAGGGTCAGTATG
GAGCTTACTTGGTGTACGGTGACAGCGACCATAACGTGTTTGGCTACAACGTGTTCACAAACACGACGGCGTCGCACTCGTCGGCGATTTTCAAGGCGTT
GATGGACCAGGCGGTGTATCGGTTCTTCGCGGCGAACAGCTCGAGTGACTCGGCAGCTTCGACGGTGAACCTGAAGGTGAACAACTACCCGTTACCGTAC
ACCACAGCAGCGAAAGCGGTGTTCAGTTCATCCACATCGTTCACCGCGGCGCTCTTCGTGTGCATTGCGTTCACGTTCCTGCCGGCATCGATTGTCGTAT
TCCTGGTGAAGGAGAAGCAGGCTGAGCACAATTCGAAACACCAACAGCTCGTCTCTGGCGTATCGCTGCCTGCGTTCTGGTTGTCCAACTACATCTGGGA
CCTGATCATGTACATCTTCCCGTGCGTGTCCGCATTGGTCCTGATGGTCGTTTTCAAGGTTTCGGCATTGACGGGCCAAGACTGCGATAGCTGCGCGCCA
GAAACGTTCCCTGCCGTGATCCTGCTGTTCATCCTCTTCGGCCTCGCGATCTGCCCGTTCACATACTGCCTATCATTCCTCTTTAAGGAACACTCTTCTG
CGCAGACTTTCACGATCGTGCTCAACTTTATGATCGGTGTGGTGCTGATGATCACCTCGTTCGTCTTGGACATGTTCGACTCGACTGCCAACGTGAATTC
GGTGCTAAAGTTTTTGTGGCGCTTCTCGCCGCTGTTCGATCTCGGAAATGCTCTTCTTACCATGGTCACGAATGACGTCGACAGCATTCAAAACAGTGAA
ACTGACACCACGAGTCCGTTCAGCACCGACATCATGGGATTCGAGCTACTCTACCTCGCGCTCACGGCCATTGGGTTTATGGGCTTGACGGTCTACATCG
ACTACTCCAAAACGTTCCCTCGAAAGGAGGAGGCGGGTACCAGCGACAACGTTGGCGAGGACCACGAGATCGACGAGGACGTGGAAAAAGAAGCGCAACG
GGTTGCTTCTGGTGGCgctgacggggacgcggtgaagcttgtgggactccgtaaggtttacccgggtggcaaggtagctgtccgcaatctctcatttggc
ttgaaacgtggtgagtgttttggcttcctcggtatcaacggagctggtaaaacaaccaccatgaaaatgctcacgggcgacgttcaaccgagtcatggca
ccgctacgctgggcgggttcgacattctggcgcaacagatcgaggttcgtcgacaaatcggatactgcccacagttcgacgccttgttcgacttgctcac
tgtgcgcgagcacctggagctcttcggtgcgatcaagggtgtaccgcaagactcgttggagcgtgtcgtgatggagaaaatccaccagctgaacctcgca
gacttcgagaacaagcttgctggcagtttgagtggcggcaacaagcgcaaactgtcggtggccatcgccatgatcggcaacccggccatcatcttcctgg
acgagccttccaccggtatggaccctgtctcccgacgattcatgtgggacgtcatcgcggacatttcaactcgtggcaaggagtcgacgatcgttctcac
cactcacagcatggaggagtgtgaggcgctgtgctcgcgcgttggcatcatggtcggcggtcgtcttcgctgcttgggcagcgtgcagcacctcaagtct
cggtttggagatggcctcgtgttcgatgtgaagctGGACATGCCTACTGCGGATGAACTGGAGTACCTAGTCCAAAGCGTCTTTGGTAACGGCAGTGAGT
TCGTCACGCCTGCAGAACTTGAAGACAAGTGCCGCGCATTCGGCAACGTCCAGCTCGCCGATCGAGTCACGGCGTCGCACCCGACCGGCTACAGTCTTGC
GGCCGCCATGGAGCGCGATGGGTTTGTCCGCGCCGAGGCCTTCTGCTCGTGGTGCATCGAGGAAACGCGCTTCGACAAGCTTAACGATTACCTCGTGCAA
TCCTTCGGTGCGGGCCAAGTGCAGGTGATGGAGCGCCAGAACGACTTCGCTCGCTTCAAGGTGCGCAGCCACAATAACGAAGTAAAGTTGTCCAAGATGT
TCGCGCTGGTTGAAGATGTGAAAACCAAGATGCAcatccgcgagtacagcgtttctcagacgactctggagcagatcttcaactcgttcgcgagtcagca
ggaggaggaacagGGCGTCGCTCGGGGTGTTTTCCAGT