Description :
From Genome Similarity Track
Location :
Scaffold_155:15880- 17690
Transcript NameFunction/comments
Phymu_g5664hypothetical protein
Phymu_g5665fumarylacetoacetate (FAA) hydrolase, putative

Sequence
1810 bases(100 bases per row)
CAAGGCCAGTGTGGTAGTTGCTGGGCCTTCGCCACTGTCGGCGCATTGGAAGCCGCGCACTGCATTGCCAATGGTGACAAGACGGCGGCCACATactcgg
agcagcagcttgtgaGTTGCGACACGAAAGACTTCGGCTGCAACGGCGGTGCCCCCGTGTACGCGATGGAGTACGTTCGCGACAACGGCATCTGCACGGA
GAAAAGTTACCCGTACACATCCGTCGATGGCggcaatgcagcagcttgctcgAATTCGTGCACGCCTATTAAATCAGGAATTACGGACATTGTAAAGCTC
ACGTCCGGCGACGAGAGTGCTCTCCTTGGtgcgttgaagaagcagccggTGATCGTCTCCGTTGTGTCGGACACGTCGGCGTGGAAGCAGTACAAGAGCG
GCGTCATCACGTCTTGTGAGACCACGACGGTCGACCACGCCGTGCTTGCCGTTGGCtacgacgccaccaccatCAAAATCAAGAACTCGTGGGGCACTGA
CTGGGGCGAGGACGGCTACGTACGCCTCAGCCGCAACACGCAGGGCATGGGCACCTGCGCCGTGCTCACCGACATGTCCTACCCCAAAGTGTAGTCCCGA
CGGCTATCGAAGCCTCTCTATCTGGAAGAAAACAAATATACGTTAATTGTTAGTCAAAAGAGTGTTTGGCAAACGTTTGCCAAGAGTAAAGttgccttca
acttgacaGGGCTGCAACTTTTGTGTACGAAACACCATTTCAATTAGATCACACAACCCTCGCATAGAACTGCCAGTCAAGCATAGCCCGAGCTTGGATC
CGGTCACGTGATGCCTGCATTGCTGCGTCTCGTGCGTCTCCGCTCCAGTCTCCCCCGCCTCGCCATGAGCCCCTCCCTGCGCCActtctcctcgccgtcc
tcgagctccaaggCCACCGCCCTTGTGCgcttcgtggacgagaacggTGCCATCCGCTGCGGCCAGCGCACTGACGACGGTTCCACTGCGCTGTTGATCG
AGGATGATAATCCCCTGGGCAGTCTGCACTTCACGGGCGAGACTGCATCTAtcgagaaggtgctggcgccTGTGGTGCCCTCGCAGATCTGGTGCATTGG
TCTCAACTACAGCAAACATGCCAAGGAGACCAATATGCCCGAACCGACGTACCCCGTGCTCTTCGCGAAGGGCGTTAACGCCCTGCAGAACCCGCACGAC
CCCATCGTAATTCCCCGCATTGCAGCAGACCCCCCTGAGGTCGACTACGAGTGCGAACTCGCTGTTGTGCTGAAAGAAGCGGCCTTCAAcgtgacggagg
aggaagcgctgaCTTACGTCGGCGGATACACTTGTGCCAATGACATCTCGGCACGTCGCTGGCAGGGAAAGAAGGGAGGAGGCCAGTGGTGCCGCTCGAA
AACGTTCGACACCTTCTGTCCACTGGGACCTGTACTCATGACGCCTGAAATCATCCCAGACCCGCAGACACTGGAGATCGCTACGTACTTGAACGGAGAG
CAGGTGCAGAAGTCCAACACGAGCGACATGATCTTTTCAGTTGCCAAGCTCATCAGCCAGCTCTCGCAAGATTGCACACTGCCCAAGGGCACGCTCATTC
TCACGGGAACCCCTGAGGTAAGTTGTAATTGTCTGGTCTAACTGTATGGAGAGGAGTCTAACTTGACTTGTTGCTGCGTGTGTTGTTTGTGAAGGGTGTT
GGCTTCACTCGCAACCCGCCGATCTTCCTTGCGCCTGGTGACATGgtggagatcgagatcgagcgtATCGGCAAGCTCGTGAACCCCGTTGTTGGCGCTT
CCGCGTTGTA