Description :
From Genome Similarity Track
Location :
Scaffold_323:1588- 8565
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_323-snap-gene-0.7Novel protein.
Pytul_var.sporangiiferummaker-pug3_contig_323-snap-gene-0.14Conserved gene of unknown function

Sequence
6977 bases(100 bases per row)
CGCCGAGCAGCTCGAGCCCGTGAAAGGCTGCGCGCAGGGCGTGCTCACGATCGACGCGGCGTTCGTCTCGTTCGACCCAACCAACCCGGATCAGTTCGTG
ATTNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGTGTATCGCGGCAAAGGCTCCAGTCTACTGCGTCACGTGCACGTTCAAGGACCACGAGGGAGGCCATC
GTCACAGCAGCATCGCGCAAATGGGACTGGGGGCGACTTGGAGCCTGTGGCGAATGCTGCTATGCTGGACACGGATGAAAAACGCGGTCAATGGGTCTGC
CACGCGTGGGTGAAAAGCGATCGCTTCCTGGCAGCCAACAAAGCTGGAGAGCTCGTGCTCGTAGACGCCCCGTCGGCGACAATCGTCCAAGCGATCGACA
CTTCGAGCTACCCAGTGCGGAGCTGCATCACAGGCATCGTGTACACGGTCGAGTCCGTTGTCGTCGCTCACGACGATGGGCATATCTTGTGGCTGAACGA
GAAGCACTGGGACATCATGCAGTCGGCAGCATTGCCTGCCCCAAAGGGCTCTGCAACTGGCGCCAGTAGCAGCACCACGACTACTAGTGGTGCAAGTTCA
GGCAATAGCAATATATGTACATTCCACGAAGGTCCCGGTCTCGTGGTGAGCATGGTTGCATCTCCAAACCACTCGAAAGTGTACATTGGGACGCGCGAAG
GCAGCATCTTCGAGCTCAAGAGCATGGTCGCGCTCGACGACGACGAGGAAGAGGAAAGCGAAGCTCCTCGCACGTCAAGTGGGGTGCGGTTGGCGGTGAG
TGACGGTCATGCCGCCAACGACCACCTCGTGGTGCCCTGTGGCAGCTACCCTGTCGGCGCCGTGTTTGCGAGTTCAGCGCTCACGCCATGTGGAGGCACG
TTTGCGAACGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGCGAGCGGCGGTGTCAATGGCCGCTTGTACTTGTGGAGTATCATGAAATGCCGCCT
CGTCGCTGAAGCGAGCGTGGCATTCGTGTTCGCGCACTCACCGTCGGCGGTGCATGACAGCGTCCCGCTGTCCTNNNNNNNNNNTCTCGGCGTCATCGTC
GGGGGATAGCCTTCCGAGCGTTGGCAGCCTCGAAGATGGGGCCAGCGCGACCTCTGTGATCGTTACGGCACTCGCGTCTCGTGTCACGGACCCAGTCCTG
ATCGTAGGCGATCACACGGGACGCCTGCGTGCTATCTGCGTATCCAAGATCGTTGGCGGCAGTGGTACCGTCGAGTTGATCCCACTGCACTCGCTGCAGC
TTCTCGGTGGCGGGAACCCGTTGGACATCCTAGAGATGCACACGACGCAAGCCGTCGTTCTGGCAGCGTCCACGCGCGGCAACGCAGTGTTCCTGCTCTC
GATGGACCATGAAAAGCACTTCCAGGTCATCGCGTACTTTACGCTTTTGGAGCCCAACGAGCATGTCGTGGACGTGAAATGGAGCGTGCCGACGCACAAC
GCGAGCGCATTGATCGTCACGTGCTTCTCGTCCAGAGGGCTGTTCTACGTCGCAAGGTACCAGCAGACAGCGACAACAGCAACGAGCTCCTCCTCTGATG
CCGGCAACATTGGCGAAGCGCCGCAGCGACTGGCGCCAAAAGTAGTCGCATTCGGTGAAGACATGCTCTCCAAGTGCGCGTCAATCACGTTTTTGAGCAA
TGCGCCCATGAGCATGATGCTCGCGATCGCGCCGCAGGGGAACCACCTGCACGTGATGAAGTACAAGGACATGGTGCTCGATCCGACCGAGAAGCTCTCG
GTTCTGTCGAAGGTGCTCATGCAGGATGCCCACGAAAATGGCGTCGCGACCATGGCGCTGTACCCTCGCACGCTGGCGGATGGTAGTGAGATGGTCGCGA
CAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATCATCTACGTCAACCCCAGT
GTCATCTGTGGCGATGGCGGGCAACGAGTGGCAGCTCGAAGACATTCAGGCCGCCAAGAAGAAAACGATCGTCGTGCACTCGGGCCCCTTGACGTCTCTG
ATGTTCGTGGACATCGAAGACGATTTGTACTTGGTCTCTACGGGCAGCGACGGGTGCGTGTTCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTGTGATGTTTGCCAAGTACAACGACGCGTTC
AAGCCGGCGCAGGAGCTCGACGCCAAGCCGTTCCTACAGGCGCTGGAGGAGCACGAGGAGTTNNNNNNNNNNNNNGTGCGCGCAATCGCTTCGATCGATT
GAAGGACCAGACGCGCGCACAACTGAACGACCTGGAGATCAAGCTCAAGGTCATGCTCAGCGATAACGACAAGCTGCCAGAGACAGAGCGGCTTCCGCGG
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTGGCGTGACCAGCTGGTCAAGAAAAATAAGGAGCGCGCCGACCGGGTCCGTGACGGCATCCT
CAAGGACTTGGCCAAAATGAGCATCGTTCGCGAGCGCATGAAGCTCGAGTTCTGGGACTCAGCCACCGTCCCGGGCGTTCGCTTGCGGGGGTTAAGTGCG
TCTCCGTCGATGCTGCAGCAAGGGAATGGAAGTGGGAGCAACCCCACAAACGGTAACTTGTTCGTGTACAATTTCCCGATGCGACGGCAAAGCAAGCAAG
AGCTTCTGTTGACCAAGAAGATTGAGCTCCTGCGCACGATCGAGTTTGCACACCAGCAGCAAGAGCAAGAGGAGCAGGCCGCGATGACGATGACGGCAAC
GGCAATACCCCAGAAAGAGACTGCGTGGCGTCGATTCCGGGATGTCGTGCTCGCGCCAAACGTGCAGTGGCTCATCGACGCGGGCATCCATCATCCGTCG
TTGAACAAGTGGCTTCTAGATAAAGGCATAGGTTCAGGTGGCGCTGCTCTCACGAAAGATAGGGACAAGAACGCCGAGATGCCTGTTCTGCCACTTCCTG
CTTCCGTGAACGAACTCCAGAGCTACCACTTGGTGTACCACCCGGCGGCAATCCGCACACGCAAGCAGCAGCGCATCCAGATCTGCTTGCTCAAGTCATT
TGTGCGCTTCCTCGTCATGGCATTCAATGATGAGTTCAACGCGCTTGTGACGCTCAAGGCGGCGAAATTGGACGAGATCGACGCGAAAAACGCGCGCATC
GTCGAGATCTGCACCGACTTGGGCTTGCCCACGGTAGCACAGGATCTGTATCGGCCACAATGGAGTCCCGACGAGATCGCAGCGTCGATCCTTGACGTGA
AGCCTGAGGAAATGACGCAACCAAAGTACGAAACTGAGGCCATGCGCCGCCAGCGCGAGAAGGAGGCGGCCGAGAAGCTCGAGCTTGAGCGACAGCGCCA
GAAGGACGATGTCGCGGGCCGAGCTCTCCAAGATATGATGGACGGCACACTCGAGGTCAAGAAGGAGAACCTGGCGTCCCAGTNNNNNNNNNNNNNNNNN
NNNNNNAGGAGCCGTGGATGCTCGAGATCCCGCTGGACGAGATGACCGCCGAGCAAAAGAAACTCGTTGCACAGTTTGAGGCCGCGCAGCAGAAGTTCCT
CGACGAGAAAGAGAAGTACAAGAAAGCGCTCGATCTGGAACTCAAGAAGATCCGCAGCGAGATCCAAGAGATCTGCAAGGGCTTTGACGACAAGTTGCGC
GGGCTTCAGGAGACGTACCTGCAGATGCGCCGCAGCGTGCTCGTGCAGCATCTGTACGAGCTCCGCCTGGCTGAAGACCTCTTGGATCATGAGCACCTGG
GGGTGCGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTGCGATTCGCGAACTGCAGCACGCGATCCAGAAATGCGAGCGCGAGAACGA
CGTGTTCGCAGTACAGCTCGAGACATGCAAGGACGAGTGGCACCGCGCGGTCGAAGAGGACAAAGCATGTGACAAGAACTTCCTTAAGGAGCTCGACGAG
CTCGTGGGATCTGGCGCGGGGGCGGCACCACTGGAGCACGACCTCACCAAGCATCTTGTGGAGCTGTTCAAGAAGCGCAAAGGTGACGACATTGTGCGTG
ACCACGGCGACTTGGGACTGAAAAAAAGTGGCACGAAGCGAGGCAAGAACCTGGGTGGAATGAGTGGTGGCAGCTCTGCGTCTCTCCTCTCTGGTGGTGG
AGCAGCAGCCGCCAAGCAATGGCTTCTTACCGATGGTTTGACCTCGGATCCGTCTGCACGTCAACTCTCCACCGTGACGCTGCTGCAGAACCTCCAGAGC
TCGTCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAACGACGGAACCGACGACGAATCAAACGTCGATCCATTCCAGTACGTGGACTTCCAGCAGC
AGCAAACGCCACTGCGTCGCTTTGATAGCAACAACAGTGTTAATGCTGTGAGTCAGCGGCATGTGGTGCCGTTGGACTACGACAATGATCGTCCTGATGG
CGTCGTGATTGAAGACCGCGTGTGGCGCGCATTGAATACGCTGCGCACGAAGAAGATCTTGGTCGAGCACAGCGCGAAGGAGAAAGCCGAGCAGTACGCT
CTCGCCAAGGGCGTCGCCGACGAATTCAGGCTCCAACTAAGCGAGCTCCACGTCGCGCTCCAGGACCAACACTCATTGTNNNNNNNNNNNNNNNNNNNNN
NNATGCAACAGCTCGTCAATTGGACGCGCTCGCGAACAGCGCGCCGCTGCTCGTGCACATCAAGCAGGGCCAGGACGAGTCGAGNNNNNNNNNNGAGCTG
CTGCTCATGCAGCGCGGGACGGCGATGACGGCCACCAGAAAGGACGACGACGCGTTCCTCGTGGCGCGCGCGAGCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCGTGATCCAGCTCCACGGCAAGGATCAGGTCGGGATCCTGAGCAAGATCAAGAACTTTCGCAAGAACATCAACATCATGGAATGGGAG
CACACGCTGCTGGAGCTCCAGACCAAGGACATGGAGGAGCGGTACACCGACATCCAGCTGCTGCGCGTGACCAAGGATCTCCAGGAGCTCTTCCACACTG
GCGACACGACTCAGAAGCAGGCTCGCGAGATCGCGCTCTTGGAGGCCAAGATGGGCCACGTCGGCACGCATCATGCAAGCACATTGCTGAAAATGGACCA
GGCAGCGGCCAAGTTGCATGCTCAGTTGCGCGACCGTGTGCATGAGAATCAGCGGTTCAGCGAGCAGGTCCAGCAGCTCCAGATGCAGGTTCAGATCCGC
GAAGACATCCTTACGAGTCGCAAGAGCGCTGCTGTGCGCCATGGAACACCGGTGGCTGGCGCTAGCAGCAAGGCGGACGAGAATCCGCAGCTCAAGGCGA
TCATCGTGCGCCGGAAACTCGTGGATCTCGCCAAGGCGCAGACCGAGGAGATCGAGTACCTGCGCATGGAGCTCGATAAGATGCGGCGGCGCACATTCCC
GAGCTTTGTGCAATATCAGCAGCACCAGCAGCCTGACACCAAGTACTAGTCACCACAAGACTCATCAAGCAAGTCAGTACAACCACCAGATTGTTTTTTC
TCCGTAATTTCAAGTTCTGTATATATTTTCGTATTGCCAGCACGTTGTTTCCCCTAGCTGTCTCCTAGTTGGTTCCTTCCATTTATCCTTTGCCAAGATC
TACAGCAATGCGGCGTACGCAATGAGGCTCTGGTCACGCGCGCATTGCAACACATGCTGCTTGAGCGACAATGGCGCAGAGCGCGCGAGCAGCGCATGCA
GTCGCTGCAGCACCACCTTCGCGAGCACTCGCTGGCTTATCGTCGCATCGAGGGCAGTAGACATACTGCTGTCAGCAGCATGCACCTTGGCGAGGAACTC
GGCCATCGCTGCCAGCACTTGAGCCCAGTCTCCAAAGGTGCGCGTGTGCAGATCTGGATGCTGCAGCAATGGCTCTTGGATGATCGCATCAATGGCCGTC
AACGACGCATCGATCGTGGTGCCATGTGCAGACAATAGCATGAGCAGCGGCGCTTCCGCCTCCGCTTCCTCCATGGCGTGCGTCTTCGTGGCTGCTGTTG
CCGCATCGACAACAGCGTCGAGGATCGCACGGATCGTCACCAGTGAGCATGCCGACTGCGCGTGCTTCACGACCAACGCAGCGATGTGCGCGAGCGTTGC
GTCCATGTGGGCATCTCTGTGACGACATCGCTGGACGCGTGCACAGAGAACCGTAAACGTATTCACGATCTGCAGCGCGAGTGCATGTTGCTGGGCGCCA
TCGAGCGCGTCACTTTGGAAGTACGAACTCTGCAACGCATGCGCAAAGAGCTCCATCGTGAGCTTGAGCGTCTTGTTGTTGTTGTCCGAGAGCATTCGCG
CGCTCAGCCATTCAAAGAACGCGGCCTTGGCGATCAGGTACGCGCCGCCNNNNNNNNNNNNNNNNNNNNNNAAGCAAGCACTCAGGATCTGCGCGATCAG
CGCCTGCGTGTGGTCATCTGCGAGCTCCGAGCCGAAGAAACTGAGCAAGATCGGCAGTACGTGGCGACGCACAAGCAGCACGACNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTAGAACATCGGCACGTCGTT
GACGTCGATCGCCTGACGCGCGAGTAAAAAGTGGTTCACATGCGGGAACAGCGCGTGCACGGGGCGGCAGAGGATCGAGATCGCATCATTGAGAAAGACC
GTGATGACAGACGAGACGCGCGCACGTGGGGACTCGATCGCATTCCGTAGACTCTCGAGCAGCAAGTGCACTTGGCG