Description :
From Genome Similarity Track
Location :
Scaffold_550:1588- 7646
Transcript NameFunction/comments
Hyaar_Emoy2814315hypothetical protein

Sequence
6058 bases(100 bases per row)
CATGGGACGGAAGTCACTTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCCGGCATCTACTTATTGGAAAGGGTAACGCCCTACCTCCTGCGGCGCGTGGGGCAGTTTGTGACGTCAACGTGGGAGGA
GCTGACCCGATCGCACAACGGGTCCGACCGGTAGCACCAAGGTTCCGAGAAAAACTCGCTGATATGATTGAGGGATTACTGTCGGCCAAGATCATTCGAC
CACCTACATCACCATGGGCTTCCCTCATAGTGGTGATCATCAAGAAAAACGGAGAAGACATAGGGCTGTGTATTGATTACAGGCGGGTGAACCAGTTGAC
TAGGTTGATGGTGTATCCGATGCCACTGATCAGCGAACTATTGCAAGAAATGGATAAAGCTATGTGGTACTGCTCTCTGGACATAGCGAGTGGATTTTAG
GTGGTGGAGATGACTGAAAGAGCAAGGGCGATTTCCGCTTTTATCACACCATCAGGGTTGTTTGCGTGGTTACGGAAGCCTTTCGGGTTGAAAACGATCA
ACAAATTTACCAGCGATTGATCAATAACGCTTTGTATGGATATTTGGAGATCGGCGCAAGTTCCGAATCGATCACGGCCGGACCACCAAAGTTGATTGAT
GTCTTCACCGATGGTGATCCAGATACTGATCCAAAACCATCAGTGTTGGGTCGAATATCCTATATCGACGACATATTGATACAGCTACGTTGTGGAAATC
TCTGTGTGAGAAAGTGGAGAGATTATTGGAGGCGTGCAATGAGTGGAGTTTGTCGATCGGTTTGGCCAAACGTTTCTGGGGACGTCGCGGAGTAGAATAC
CTAGGACATAGATCGATGTCAATCTGTACCCAATTACAGATGACGATCGCGATTCCGAGGGCAAGAATCGTTGGGAGAAAGCAATGATCGCGTTCACGTT
GCTAAAGGCAAAGATATCCACAACACCGATGTTGAAGCATTTCGACCCCGATCGATTGCCTGTGATCGTAGTGTATGCTAGTAAGTGGGCTGTATCAGCG
GCTTTGCTTCAAGAATATGACGGTGTATATTGGCCTGTCACTTTCTCCAGTCGTACGCTAAATCCTAACAAGGTCAATTACGGGATAACAGAGAAAGATG
TGATAGCTCTCCTCCGGATGCTAGATATATATTATAATATGCTTGTATCCCGCGAGATTACAGTGCTTATTCGAAATTAGACACTGGAATGGTTGTTACA
ATCTTTAGGTCTCAACGGAAGATTGGGAAAATGGGCTTCTTTTCTATCGAACTGGACGTTGGAGATTCGGAGGTATGAGAAGGGAGAAGATGAAATACTC
GGCACACTTGCTGCGAGTATAAAACCCCGTGAAGAAGTGGATGAAGTATTGATTGCGATCGCCCCGAGGAAGTAGCCAAGACAGACGATAAGTATGCCAC
CACCCACGGTAGGAGTTAATGAAAACCTGCTAGTAGCCAGTTCCGATGGATCGGCTAGGTCGAAAAGAAAGGGAGGAGCTTACAGCGCGATTATATGGAA
ATTGCCGGAGTGGAAGATTGTAGCGGATGCTTCGAGTTTACCCCTGACCTGACCGTGAATGAAGCAGAATACCGAGGGTTGCTCCTTTGTTTCGATTTGC
TTGCCTATTAAGCAAGGGGACGGGTGATTATCTACGGAGACCCGAATTTAGTGATCCGCCGAATGCGAGGAGAAATTGGCTGTAAGGCACCAGGACTGCA
ATTGATGAGACATAGAGCGATGGAGGAACTCCGATCGTGGCCAGTCAATGAATTCTTGCATGTGAAGCGTGACTGGAATCAGAGTGCAGATCGGCTGGCG
AGTGAAGTACTACGGCAAGAGAAAGAAGCAGTTGTGATTTTGGATCAGGATCGTCAGGATATGATCACTCTCAATCGGTTAAGCAAATTACTACTACCAG
AACGAGTTGATCGTGCGGTCAAAGTAGCGGCTATCACTTGATCAGCACTAAGAAAAAGATTTCAGCCAGGATTTGCAGGAAGAAGTTGTGCAGCAGATAC
GTATCGGTCGCATTAAGCAAGCACAAGACGAAGAAAGTTGGGTATCCAGTCTTAGGATATATCTGGTTGGAGATGTGGGTAGATTATCGGCGACTGAAGC
TAGGGTGTGCATCCTGATCGCACCGGATTATGAAATAGACCAAAGTGTATTGCTATTTTTCTGTCCGAGATCGACCACCAAATCGGAGGACCGTACTGAA
CTGACTCGTTTGGTGGTTCCAGAACAGTTACAGCGAGACTTCTTGCACCACTACCACACAAGTTTGGGGTGTGGTCACCAAGGAATCGGCCGTACCTATC
AACGGATGAGGGCGAATTTCCATTGGCGTGGGTTGTACCGAAGTGTGCGGAGGTATGTAGGAGAGTGTGTGGATTGTGAAACGGGAAAAGGACGACCAGG
TGATCGGAGTGGATCACCTGGTAATTTGCATCGACGTACCCGTTTTAGATTATAACTATAGATCGCATCCCTTCATTGCCACTATCTTCTTAAAGGAAAC
ACCGAGCTGTTGCTGTGGGTCGATTTATTTTCGGGGTATTTGATCGCGAAAGCAATCTCGTCCAGATCCGCACAGACGATCGCGAGAAATTATGAGGAAT
TCGTGTTCAGACGATTCGGTGCGACTGAGACGATACATCATGATCACGAGCCAGGATTCATGTCCGATTTCTTCCGAGCGTTCAATCAGATCGCGGGATC
ACAAGATTGGGCCACCATGGCATATAGACCGCAGGAGAATGGTACGGCCGAGCGCATGGTGCAGACACTGACTCTATCGATCAAGATGTATGTCATGGAT
GAAAGTCAAAAGGACTGGGACGAATGCGCAGAGCGATTGACCTATGCGATCAACACCGCTCATGATCGACTTCGTGAAGACACACCGTTCTACCTGATTC
ATGGTTGGGGCCCAAGATCGCGTGGACTATTGGGAATAGCCGGTATGGCGTGCCCGCGATTTCCAACTTTACGGCGTGATCGCCGCACTTCTCGGCCACT
CGAAAAGGTCCATGCCACATATGGGCTAGCTTTCGAGCATATCCTTCCTTGACTCGGTCCAGATATAGCCAAACTCGCGACCCGCGATCGATATCCAATA
AATCTCGATCTTCATTATGTCGATTGGCTCGACCTCTGATCGCACCCTCCAGTCGCTCATTCACTACCGCCCGAGCATGTTGGTATTGGCGTTGTATACC
ATATCTCCATCTTCGGGAATCTTGATCCCGGGGTTTGGTACTCCCAAGCTAGTTCGCGTATCCCCAGAACTCCCAACGGGTGGGTTGAATGTGGATGAGG
CGAGTCGGTTTGATTTTGATGAAGCTCTGCTGCCGGAAGATAGTTGGGATGGTAATCTTGACGCAGACGAATTTGAAGTTGATAAGATTATCGACGTGCG
ATCGGGACGGAAGACTAGATAGGACCGAATACACAAGCAGTACCTGGTACAATGGAAGGAGTACAGCGACCCAACCTGGATTGAAATAGCTGATCTCAAT
TGTGGATCTATTTTGTAGGAGTTTGATCTCGATCGGGTGAGCAGGAACCGTTTTGAGGTGATGCAATCGCACGAAGAAGAATCCAGAGACTAGCGACTAT
CCGAGAACTTGAGTGGGTGTGTCTATGCAGGGACGGGGAGGAGAGTTATGGGTGCAAGGAGGTTGCACATGGAGATGGAATGGGATTTATGTGAATTCAC
TGCGACGATTGCAGACTTAATGGTGCAATCAAGATGAAAAGACAAAAAAGATGGAAGAAATACGAAGTATGGGAGCGATCGAATGGAAATGAGAAGAAAG
TATATTGAGAGATCGCGTCATGGAACAGACCAAGTAAATTGCTCGCGGTCAAAGAACTTACTAACCAAGCGTGGAAGAGACCACCCAAGGTGGGATGCGA
TCGAAGGACGAAACTGGTTCCTCCAACGCTCGGTAGCGTGATCGATCGACAAGGCAGTGATCAAGTTGGGTATGTTGATCCGCCGCACGGATAGGCTGGT
ATACCACACTCTAGCCTCATTCGGACGGGGAAAGTGTAGAAACATGGGGTCCAGTAAGATGTCCAAATTGCGGAGGCCGTCGATCATGCCTTGAAGAATC
ATCTGCAGTACCCGCTTCCAACGGGGGCCAGCACGAGATCGTCTCTGCCTTCTCGCTCGCGTAAAAGCGGCCAATCCAGGATCCGTTTTACGCTGCTCAG
CGGAGATCCACAAGAAATGGGTCGATTCCCACAGATCTTGGCGATGGCTATCCATGAAGCCTTCATACGCCTCGACCAGTTTTTCGAACCAGCCGGAAGG
CTTGAAGTAGATCGGGTGTATGGTTTGATCATAAAGGTCCCAAGGTTGTTGATCGTAAAATTGGTCAATCTTGGTCGGCGTGATCAACTGGGATGACCAG
GACGACTTCGGATGAGGGCGAACTTTGCCCAGTTGGACCGGGAAGATGTATCCCTTGGGCTTTGAAAAGTAATGATCGAACAAGTCCATGTCCAGCTCCG
ATACTCTGATCAGGCTCACTCTTCAGGCGGACCAAGGGGACACATTCGCTGCCGATCGCGGAACCCGATCGCGATACCCCGGAATCCAACGATCGCGAGG
TATGTGGGTGTCAGGAAGTGCCGAAAATTATTCAAGAGTCAGCAGTGAATTACAGGGA