Description :
From Genome Similarity Track
Location :
Scaffold_1059:1588- 3654
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1059-snap-gene-0.2Protein kinase
Pytul_var.sporangiiferummaker-pug3_contig_1059-snap-gene-0.3Carbohydrate-binding protein
Pytul_var.sporangiiferummaker-pug3_contig_1059-snap-gene-0.4Carbohydrate-binding protein

Sequence
2066 bases(100 bases per row)
GACCCCACAAGAGATCTTGAGCCGTACCAGCTTGAGTTCCAGGGCCTCTCTGGGCTCTTGCAGTGCGCACTGGTCTGGGACACTGGATACGCACTCGCGC
TCGACATTTACGGGAAGACGCGGCTCGTCAAGATCCACGTCAAGTGCGGTCTCAGCATGGCGGACATCACGGTCAACGCGGCGTACTATGAGTCCATTGG
GTGCACGTGGAACGACTACTCAACGAGCAACACGACGACAAACGTGACGAAATATTCGTATCGCGCGCCGTCGCGGTGGTGTCAAATGGAGCAGGTACAA
TGTGTAGCATTGTGCGCGGCCGAGGGAACTTCCGTGAACAGTATCAGCAAAGACGATGTGTTGTCATCTCTCTGGGCTGTCGACAACCTGAGCAGCGCGC
CTCACGACACTGTTCTAGGGATGCACGTGATGCGCCATAGCCTCACCAATGGGACCACGATGTACACAATCCACACGAACGAGCGCGTGGTCGTAGATGG
CAGCGAGTGTCCCGTGCAGCCGTCGCTGATTACCCCGTGTATCCCCTACGAGCAAATCGTGTCGCAGCAGAACGAGTGGTGCTGCCCCGTACAAAGTGAC
CTTGTCACTGCGTGGATCGCTGTCGAAGAGCGGCAACAGCTCGCTTTGGTCAACTTGATTGTGCTCGCAGATGCTGTGCTGCTCACTGTGGCCATGGACC
TCTTCATTGACCGGAAGCCGCACATATTCCGCTCGGCTGCGATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGTGCGGACATGGACCTGG
CCGAGCAGTCCGTGCATCCAAGTACCGTCTCGTGATGGTTCAGTGCGCACTCGAGTAAACTGCAAGTGACACCAATGAAAGACGAAATCAATGCAGTTTC
ATCTATTTGGTGTGCGTCCATGTCAGACGGACAAGGCAGAGAAGATACACAAAGTGTCCACCTGACCTGTCTTTACTCACATGTCACATGGAAGCGTCTC
CATCAAAAGGACATTTGTTTGTCTACAATATAAAAATGGCGTTCACATGCCAACCATTTTATGCCGCGTCCAGGATGCTCCGTGTGACGGGAAAATCGTC
GTCGATCTCGCCCGACGCCGCGTACACCATCATGCCGCCGTGGCCATCTTGCCGCGCAAACGCGTCCCATTGCGCGACGACCGCAGTGCTCGGTCCAGGT
CCGTACGCACACGATTTTGCGACACAAATGCCCAGCGTCGCCTTGGAGAAATCGTTCCCGAGTTGCGTCGCCCAGCTCGCAAACGTCGTGTTGAGCGCGC
TCTCGTACACTTGCGCCGCGGCAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCACGTTGTACGCCATGATGTTGATCCAGTCGACGTGCGGCAGGA
CGCCCGTGGGGAAGCACCGCGTGTACGACGCGTGCTCGGGGCTCTCGCAAAAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGAAAAAGTATGC
GTCGTACGTGAGCAGCATCTTGGCGTCGTACTGGCGTAGCGCCACGCTTGTGGCCTTCATCATGGCCACGACGCGATTGGCATCGAATTCCGCNNNNNNN
NNNCTCGTCGTCGACGTCGATGCCGTCAAAATCAAACTTTTGCACGAGCGCGACGGCCGAAGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGCCG
AGAGGTTCTTGTTGTTCGTCGAGCCGCCGATACTACCCATCGACGAGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TGCTATACAGGCAGACACAAAACAAGTGGCGTCAGTGCATTTTTGTGTGGACAAAATCCAACCATCAAGCCCAGGATACTGCACGTTCAACGTTTGCTCA
CCTGCGCAGCGACTGCACGCAGCTTTTCACGTACGCGTCGCTGTTCTGGAACATGGGCACGACGCTGCCGTCGGCCACGAGCGCAAAGCCCCAGACGACA
TGCGTGACGCCCACGGGTACTTTTTCGCACCCGTTCACTTCGCTCTGCCAGAACACGACCGTGCGC