Description :
From Genome Similarity Track
Location :
Scaffold_1:158742- 170676
Transcript NameFunction/comments
g40.t1hypothetical protein
g41.t1OWZ23553.1 U4/U6 small nuclear ribonucleoprotein Prp31 [Phytophthora megakarya
g42.t1XP_009515415.1 hypothetical protein PHYSODRAFT_343735 [Phytophthora sojae
g43.t1RAW41934.1 hypothetical protein PC110_g1887 [Phytophthora cactorum
g44.t1hypothetical protein
g45.t1OWZ20038.1 DEAD/DEAH box RNA helicase [Phytophthora megakarya
g46.t1XP_009515419.1 hypothetical protein PHYSODRAFT_309064 [Phytophthora sojae
g47.t1XP_009515420.1 hypothetical protein PHYSODRAFT_321827 [Phytophthora sojae

Sequence
11934 bases(100 bases per row)
CCTCTGGTCTCACCATAGCGGAGACCATCGCTCGAGACATTTATGAGATGGGTGCATCGGCCTTCGTCTACAGGCAAGCTCTTGGCAGCGGAGTAGTGGC
GCTTATTCAGTCGAACCCAGGTGACCAGTGAATCAGCACGGCCAATCCGAAGCACTACGTGATGGTTCCCTACTCGCGTCATATTCGTGCTGGCATGGCC
ATCCTCAAGTTTGACGACCTCAATACGCTCATTCCTGGATCCTCGTCGTACGCCCTGGATAAATACCCGAACTTCGTCGTTGCTTACGGCAAAGCTACCC
AAGTGATGGTCATCGTGGCTACGAACTTGGGTGACGTAGAGACCATTACGTTTGATCTGTCGGCTCGATCGTGCGTGGAGGGCCCCATTAATATCTGGAC
AACGGAGCTGAACACAACATCGGGAGCCGTATACAAAACCTCCAGCACCGACATCGTATTTGGCCAGAGTGCCAGACTCAGTGCGGGTCTCCCAGCTCAA
TCGATCACGACGTTCGAGATCTTAGGGCACTGAGCTGACCGACAGGCCAGTGTAGATAGACCTGAGAGATATCAACCAGCGTCGTAGAGTACCATGTCAG
GGCAAGACAGACACTAAAAGCACCGACCACGAACGTGTCAAACCCAAAACTTCTTATTGCTCAGCCGCTCGTTTCCCCTTGTTCGTGCCTTGAGCATCAT
TATCTTCTTGACTTGAGCAAGACAACAACATCTTTTCAGGCTGATCACAGTGTTCTCGGCAGTCTACGGCTTCTTGACGACGCTCACAAACCCACTAGCA
GCTGAAAAGTATTTTTTGTTGGCTTCCGCAACACGAGCCTTTGCAGCTTCAGGATTCATCAGCTCAATACCCTGCACGGGTGTGAAGGCAAGACTCGATG
CCAATCCAGAAAGCGGTGGCTTGCTAGCGGACGACGCAGCAAAGTTCGCGGCACGCAGCTTTTTGCTCGACTGCTTCTGTTCCTTGCGCATAATTCGCAA
ATTGCCCGATCCTTCCTGGCCAAGGCGGCCGGATGTGATTCCCATGGCGTTGTCACCATACTCTTCGTCAGCTGTCGCGAAAGACTGCCGATTCATTTCA
CGGCGTACATCCGTCATCTGCAGCCGCTCCTTGATCTTGCGGTAGCGCTTGCCACCGCGCTTACGTCGCGGTTTTTCGTCTGGGATCGGCAGTGCCTTCT
TCGTCTTGGCTTTCTGAGGTTCCTGCCATTTCTCCATTTTACCAACTAGCTCAGTCCGAAAGCGTGCACCCACGAGACCTTCCGTGTCATTTTGGTGCGG
CTGGCTGTCCACGCGCGCCATCAACGCTAGCTTTCCAGCGACAGCTCGACACGCCTTCATGCGCAAGTAGGGGGGCATACTCTGCACCAGGTCACTGAAG
AACAGGACGCCCGTATGTTTCAATGCAGCAGCGGAAGAAAACCCACTCAACACCTTCTTCTCTTGCCCCAACACCTGCAAGTTGCACGACGGGATCCTCG
CAAGCTGCGCGACACCACCAGCAAGTCCAATGAGCTGCGCTGCAATGCGAGTGCCCACAAGCTGCGACACATTCGGCGCCAAGTACTTCATGCGGCTCTC
GACGAAGCGCAGGATCATGTTCTTGTCCTTCTCCAGCGACAGCAGCTCATCACACGCCTCCATGCACGTCTTGAGGTCCTCAGGGGCCAACGGTTTGCCA
CTGGTCCCCGACCCAGTGACGGAAATGCCAATGACTGCGGAGCTGGGCAGCAGTTTAGGCAGCTCCTCTACGAGCGTCAGGTCCATCGCGTTGCCAATAG
CTTTGACCACGCGAGCGTAGTCCAGAGCGTTCGGTACGAGCGAGTCCAGCTCCGGGAACTTGGCGGCGTACGTCTCCGCAATGAAGCGGTGCACGGCCTC
GATCTCGTCGTCGATCTGCACCATCAGGTCGTTGGACGTCACCACCAGGTCGTACTCGGCGCTGCCTTCCTCGAGCTGCTGGGGCTTGGCTGCTGTTGCG
TCGTCCACGTCCACGAACTGCTGAATCTCCTGCACGTGAGCCAGGTACTTGGGTGAGCGCTTGAGTGTCGCGACGGCCGCCACGCCGCGCTGCTTCACGC
TTGAGCGCAGCGCCTGAGCGAAGTCCTGGGTCTTCTCGTCTGGCAGCTCTTCCTCGGTCGTTTGGCGCTTCCTCTTGGCCGATTGAGACGCATCGGGCAT
CAGCTCGTCGGCGTCATTTCCGTCTTCGGCCTTTTCGTCTGCGTTTACAGGCGTGGGCGTCTCCCCCTCGTCGCTGCTGCCCCCACTGAGCTCGTCTAGG
TCCTCCAGGAACGAGTCGGCCAGCGTCGACATGTCTGCAAGTATTTAAAATTAATTGTGTTTGGATTTTCATGAGTAGGTAACTGTGTTGTGGCATATTG
TGAAGTGGAAGATCGGGAGATCAATGGAAAGAAACTGTCGCAGTATGCCATATCGTAGTTTTCAATGAAGCATACAAACGCCAAGTGGCTTGTCTTGCCC
GCGAAAGGACACGTTTCGGTTGGTTTGTGGCCGTTTAACTCACTCTTCAGTTTTCTCCCGCGGCCACGCACGCACCCAAGTCAACTCAAGATGCCGGGCC
AAGACCACAACGACAGCAACAACGGCAACTGGCGCCGCAAGGCGCCCGCCGGCGACCGCAAGGACAGCGACGCCGAGCACAAGAAGAAGCGCCCGCGTCG
CGGCGGCCGACGCAACAACGGCAGTAAGAACTCCGAGCAGACCCAAGAGACCGCTGCCCCGGTGGCGCAGGAGGCTCCTGCTCCCATTGATGCTGCGCCG
GTGGAGGCCTCTAAGCCCACGAACTTGGACTACCTGTCGGACGTCCTGTTCGCGTCGCTGGACATCTCGGCCCAGACCAAGCGCGCCATCGTCGAAGACC
TCAAGTACGAGCGCCTCACGAACGTGCAGAACGAGACGTTCCCGCTCATCATCGAGGGCAAGGACGTGTTGGCCAAGGCCAAGACAGGCAACGGCAAGAC
CATGGCCTTCTTGCTGCCGGTGATCGAGAACATGGTGCAGGAGGGACGTCGCCAGGGCACGATCCCAACGCTTGCCATCTCGCCCACGCGCGAGCTGGCG
CAGCAGATCGCGACCGAGGCTAAGCGCCTCACCAAGTTCCACGAGCTGAACGTGGCCTGCTTCGTGGGTGGTGCCAACATCAAGAAGGACGAACGCACGC
TCACGAGCAGCGCGCCTATTGACATCCTTGTCGCTACTCCTGGACGTCTTGTTGACCACTTGAAGCAGAACACTGGCAGGATCGCTGACCGACTAGGCAA
GGCCAGTGTGCTGATCCTGGACGAAGCTGACCGACTGCTGGACATGGGTTTCCGCCCGGATGTCATGCGCATCATTGGCTACCTGCCGAAGCAGCGTCAG
ACGCTGCTGTTCAGCGCCACACTGCCTGCTTCGACAGAGGAGCTCAAGCGTGTGGCTCTGCGCTCGGACTACGCGTTCGTAGACACGATCGACGAGAACG
AGGCTGACACGAACGCGCAGACGGAGCAGGAGTACATTGTATGCTCGATGAAGGAATTGGTCCCCATGATGGAGCACGTGCTGGCTGCGCACATGAAGTT
GCCGGCGTACAAGGTGATGTTGTTCTTCCCTACCGCTCGCTCGGCGCAGTTCATGGCCCAGCTTTTCCAAGCCGCGGGCTTCCCGGGTGTGCTTGAGATT
CACTCACGCAAGAGTCAAGCGGTGCGCACGAAGACGGCTGAGGCCTTCCGTAAGGGCCACAAGGTCATGATGTTCTCGTCGGACGTGTCGGCGCGTGGCG
TAGATTACCCGGATGTGTCGCTAGTGCTCCAGGTGGGTCTCACTGACCGTGACCAGTACATTCACCGCCTTGGACGTACGGCGCGTGCTGGTATGAAGGG
CAAGGGTGTGCTTATCCTGTCCGAGTTTGAAACGACCCTATTGAACCAGCTGACTGACCTACCTCTTGAGCCAAGCAAGAACTACTCGCCGGCTAAGCTA
GTGCCGTCCCAGTCGCGCACGTTGAACGTCATGAAGAACTTGAAGAACCACGGTGACTTGGAGAAGTCGGCGCAGCAGTCGTACCAGGCGTGGCTCGGTT
TCTACAACTCGAACGCGAAGCGTCTCAAGCTGAAGTCGGTGGAGCTCGTGCAACTTGCGGCCGAATACAGCGACATGATCGGTCTGGACGAGGTGCCCAA
GCTCGAGAAGAGGACACTCAAAAAGATGAACCTCCTGGGAGTACCTGGCATCGAGCCTTCGCCGTACACGCGCGACAATAGCGGTAACATGACTGGCGGT
CGTGGTGGTGGCCGTGGAGGTGGCCGCGGCGGTGGTAACCGTGGTGGCTACGGCCGCAGATAAGTCATCAAGGTCGCTGCGCCCAAGTCTGCCAGGACCA
AGCTGCGCCTCGACGACTGGATTTCGTAGTAGAACGCCAGGTGACTTCCTCATCATTAGAACCCAATCGTAATTTATTGCAACGAAGGATGAGTCGGTTG
ACTAGAAAAATATCGAGAACTCCATTGAGTAAGGTTTGCAAGTTGCCGCAGTCAAATGTAGCCAAGTCTACTACCGACTGTAAAACACGAAACTTTCCGC
GCCATTTTTGAAACTGAAGCGATGGACGACATGGCCAAGATGCTGGAAAGCTACACCGGAGGACTGCAGCAGTCGTTTGAGTCGGTCTTCGAGCGCGTGG
GGCAGAGCTTATCGCAGAGCGCGCAGGTGATGCGCATGATGAATGACGTGATGGAGTCCGCCATGCTACAGAACCTGCTCATTTCCTCGGGCTTCAACGG
CGCACGCGGTCAACTGGTGATCGAAGTGCAGAACCACTCGCAAATCATGCTGGGCCCGACCAAGATCAGCGCGCGACTGGGCAACGAAGAAGCAAGTTTC
TTCTCCATGACAGTCGAGTCGTTCAGTGCGGGGCAACGGGTGCAAGTGGATGCGCCGGTTCCAAACGTTGTCGGTCCGATCGCGGGCTTCATCGAGCTGG
AGTGCATCAGTCCCGGCACACAGCAACCCCTCACCAAACGCTCACCGTTCCGAGTGTTTTATTTCCAGAAAGGAAGCTTCCAAGCTGTGAGAAGGGGCGA
AGAGGGCGCTGTTCCCGGCCCTTCTGAGGTGGTGGTGGCGTCGGATAGGTTCTTGTTGACACGAGTGCGGGAGCTGCTCGACCTGAGCCCGATCCAGGGC
ATCCTCACAGAGGAACAGGGCCGGTATCGTTTCGTACCTGCACTGCAGCCAAGCAATGGAACGGTGTTTTACCTGTCGGTCAAGGATACTTCTGGAGTTG
GCGGGCCAGCATTCCTAGTCTCGGTGTCTGCTAATGGAAATGCAAGCACCTCTGAGCTTCGAACTCGATGCCAAGAGATTATTGACGAGATGGAGATCGA
CAGCGACGATTCGGACTATTAGCGAAGTGCTCGAGCGCGAAACATGCTGGAGGCTGTGGACCAATAAAGCGAAGCACGATTCAAAAAGTATGTTGGTGTT
GAGAATCTCTATCGCCATTGCTTTTTACTCCAGTATGGCTCTTTGCTCGGGTTGTTGGCAGTTTATCACTGCAGTCAGTCAGCTTCAATAGACTGAGACG
TAGTTACAAGCTGCCACTAATCTATGCCGTGATGCCATCATGCAGTTTATGCCCACTGGCGCTTGGAGAGATAACCCCGGTCGCTGAACCACTTGTGCAG
CAGGAAGGACTGTGCACCGTACATGGCGCCCAGCACAGCAAGTTCGAACATCGTGTAGTAGACGAGACGGTACTTGCTGCTCTCAAGCGCTGCAATACAG
CAATAGCAATGAACGAGCCGTTAGTCGATGCAGTTACAACAACCTCACACGAATTAGTCAACGTCGCAACTCACTCTGCACATGGCGGTGTACTCGTGCG
CGATAGTAGTCCTGCTCGTTCCGGATCAGCTTCAGCAACGTCTGCAACCTGTCGAGCGACGTTTTGACGCCTTCCCTGTGTTCTGTTTTCAGCACAAATC
ATCGAGTCAGCATACGATCCACTCGACCAAAAGCCCAAGACGGTCCGCACCTTGGCGCGCCTGGTTTTCCAGCTTGTCCTCCTCGCCCAAATCGTTCTCG
TTTGACAGGTCAAAGGACGTGTACCACTCCACGGTCTTGTGCTTGCCGTCATGCATGTTGTCCAGGCAAAAGCGATACCATCCGCCGCGGTGCTCCGACT
CGAAGTTGAAGCCGCTGTGCTCGACGTTCTGGTTCATTTCGTCGTGCGGCGTGACCACCACCTGGTCAAAGAAGTTCTTCTCCACCTTCTCCTCCTCCGG
GTACGACGGGAATGGGCCGTACGCCTTCAGTCGCACGTCGTAGGCGCCCGTCGAGTCCAGCACGCCGATCTTCATGAAGGCGGTACGCTTGGTGCGAACA
TACTCATGGAAGCACTCCTCCACGCGGCCGTCCAGCTTCACGATCATGGCGTCTGAGGGTGCGGGAACCACCATCAGCACAGCGACAGATGCCGCCAATA
CACGCAGCAGTCGTCCGAGCGCCATGGTCTCCTCGTCCAGTTCAGGTCTCCGCTGCCTCGTCAATCGCACAATGAGGGCCCAAAATAAGATTCAGTGACG
TCACGTCTATCTCCCACAATGTGTATTTATAGCCAATCCCAGAGACGCTAAAAATAGCACTCGTCCCCAAACGACGCTTTTATAGATACCTAAACGGGCT
ATTTTGGGTCACAGCCCGCGACCTACCATTCGACGATGTGGACGACTCGCCACCTCTCACTGCTGCCGTCAACGCGCTTGCTGCGCCGCAATTTCCGCTC
GAGCGCCGTCCCATGTGCGGCTAGCAATCACCTGTCGGACGTTTCGTTCGCATCGCTGCCAATCACCCAGAAGTCCAAGGATGTGTTGACGCGCGACATG
GGCTACGAGTTCCTCACGCACGTGCAAAAGGATACGCTGCCGCTGGTTCTGGAAGGACGCGATGTGCTGGCCAAGGGCAAGACCGGCAATGGCAAGACCA
TTGCATTCTTGCTGCCGACGCTTGAGCGTATGCTCAAGAACCCGCAGCAGACACAGGGCAAGATCTCGGCGCTCGTGATCTCTCCGACGCGAGAGCTGGC
GCAGCAGATCGCAGTGGAGGCCGTCAAGCTCACGGACGCCCACGGGCTGCGCACATCCTGCTTTGTGGGCGGCAGTTCAGTGAACAAGGACATCAAGGAA
CTGACAAAGCCCGGCGGCATTGACGTATTGGTGTCCACGCCAGGAAGACTGCAGGCTCATCTGCAGGACGACAGTGGACACATTCGAAAGAGGCTGGACG
GACTGAAGGTGCTTGTTCTGGACGAGGCCGACCGCCTCCTGGACATGGGTTTCCGCCCCGACATCATGCGAATCATCAGCCGTTTGCCCAAGCAGCGGCA
GACGCTGCTCTTCAGTGCGACGTTGCCGACTGCCACAGAAGAGCTCAAGGATGTGGCGCTGCGTGACGACTATGCCTTTGTGGATACGATCGAGGGTGAC
GACCAGCAGACCAACACACAGGCTGTGCAGGAGTTTGTCGTGTGCGCCTTGCAAGACGTCATTCCTGTGGTGGAAGGCGTGCTGGAGGAGCACATGAAGC
TGGCGGAGTACAAGGTGATCGTGTTCCTGCCGACTGCGCGGGCGGCGCAGTTCATGGCGCAGCTTTTCCAGGCTGCTGGCTTTCCCAATGTCTTGGAGAT
GCACTCACGCAAGAGTCAATCTGCGCGCACCAAGGCAGCGGATGCCTTTCGTAAGGGGAAGAAGATGATCATGTTCTCTTCTGACGTGTCTGCCCGTGGC
GTCGACTACCCGGATGTGTCTCTCGTCCTGCAGGTTGGTCTCACGGATCGCGACCAGTACATTCACCGACTCGGGCGAACTGCCCGCGCAGGTATGGAGG
GGCGTGGCGTTCTGGTGTTGGCCGACTTCGAGAAGGCATTGCTGCGTGACCTGGCCGACCTACCGCTCACAGAGCTAGAGCAACATCCTCAGCTGGACAA
GCAGAACTACCGAACAACGCGTGCTCTCGCTAAACTTGGTACTGGCAGTCAGCTCGAACAATCGGCAGAGAAAGCGTATGCTGCTTTCCTGGGGTTTTAC
AACTCGAACCTGAAAAAGCTGGGCATGTCGAAAACGGACCTTGTCGAGACGGGTGCTCTCTACAGCCAGCTCATTGGGCTTGATGAGGTGCCGATGCTGC
AAAAGAAGACCTTGCGAGCGATGGGGTTAATGAATACCCCCGGTCTCGTTGCCGCTTCAAAACCAACGAAGTCCCGAGGAGATCACAAGCCTAAAGGAGG
AGAATTGGACAGGTTTACCAGCAACATTCGGAGTGGCAGTGGTCGGTCGGGCCACAGTAAGCCGCCGACACGCGAGGGCTCCGAAAAGCGTGGAGGTAGT
TCGTGGAGATCGTTTAGCGACGGTGAAGGCAAGCCTTCGCGCAGTAACCGGCCGATCCAGGGCAATCGAAGCGCCTCGCCGACCGGCAGACGTGAAGGAC
GTCCCTACGAACGCAAGCGTTCAGAGAGCCCAGCGTCCAAGCGAAACTACAAGGAGCCGCACAAGAGATACTAGAGACCCTTGACCCCCATCAAGCAAGT
AGAAAAGCGACGTACCATTGCAGAAAACCAAGGTAAGGTGCTCCGGTGTCATAGACTTCAGATGTATTTCTCGATTGTAGCAAAACACGCAGCTCATAAC
ATGTCTGCTCCTTCACCGTGCGTTACTACGTCCGCGCCTGTGCACTGTCCCAACGAACACCTACTGATAAACACTCGATCTCCTCACTCCAAGCGCGCTG
ATTTACTACGCAATGGCCTGATACCCGGACAGTCGTTGACGTTCAGTGATAAGCCACGTAACTAAGGCACCCACGACAGCTCCAACAGCAGCAGCAAGAC
CCACCTCAGCGATTGAAAGAATCCTTGTGGATGTTGCACTGTCCCCACCAGTAGACTGCTGCACCACTTGATTGGCGTTCTGGCGACTTTCAAACAGCTC
GAGCTGTTTTTCCAATGCTGGAACGTGCGGCGGTACCAGCGTAGTGCCTGGCCACTTTGAGAACTCGCTAAGTTTGAGCCACCATTCTGGGTAGCCAGGC
ATCTCCATTTCCTCAGGAGCCTCGCCGGTGGTGATATACCCATCTGTGAATTTGCCCACAAGCTTCCACGCGAATGACCACCATTCATCGACGACTCGCG
ATGCTAATCGATTTGACTGCTGTTGCAGATATGTGCGTGCTTCTGCTGCTGTCAACGAGCTGGTGTGGGTAACGTGGTGCTCCATAGCTGTTCGCTCGGC
AAAACATGTCTTTTGCAGCTCAACAATTCGAGCGCGGATGTCCTTGCTGATAGCGTCAAAGCGGATCATGCTCCAGTTGTTTACGAAGCTGAAAGCCCAC
CATGCAGATCCAGGCGTGAACTCGCTTTCCTTTCCAAGGGTGTAGACTGCGGGGATCTTTTCCTGTGCGCAGGAGAAAGGCACATATACCGAGGCATGCG
GGGAGCTCTGCCCGTACCAGGCCACTCCACCTACAGCGTCGGGGAGATGACCACGAACCTGCAGCACGAAGCTGTAAACCGTGCGATACATGGAAATCGG
TCGCTCCCAGCCACCAACCACGCCCTTTTCGTCACCTCCCCAACGCATTGGCATTCCAAACGGCCCAGCAGCAAGACCCTTGGACAAGTCATAAGGAGTT
CCTTGAAAGTAATCACGTAGCAGTCTTGTCACGTCCGAGACATCAAGGTTCCGGTCTGGTTCGACTGAAAACGGATACGTTGGGAACTCTGGGTAATGTC
CAAGACGGGAGTCTAGCTGTAACGACGGCGCCACAAGATCAAACACTCGCCACATGCGACGACCCATATACAGTGCCCGTACAGGATCAGGAGTCGGAGA
AGCGTAGGCAGCGGTGAAGTCGAACGGCTTGCCTTGTTTCGGCTCCCACCAGCCCATTTCCTCAGCAAAGGACAACACGTTCTCCGACGCCAAAAAGCGA
TCTGGATCGTCCAGATCCATCTCACGGATCACAAATCCGTTGGCCACCACGACTACATTCGTGTCAAGTACACGCTGCGCAGCCCACGCCGCACTCGCAT
TGTGAGGGCCCGTCAGGACGTGAAAGACCCACACTTCCCCGTACCGGTCGGTGATGCCCAACGCCTCAGCAGAGCTCACGTACCCTGGATTGCTGGGTCG
CCGCTGTCTTCACTGAAGAACCCGTACTTGACAGCCAAGTCGCCCATGGTCTGCACCGCACAGCGAGCCGAGTCGCAGCGTTCCAGGGCGACTTTGGTGA
GCTCTCCGATCCCAAAGACGTTGTAGCCGTGTGGTCCAGCGTCCGTCGGCCATCCCGCCGTCCTGGCCCCACACGTGCTCTCTCCGATGCTGAGCTGCAC
CTCGTTCATGAACCCGTAGTCCTGGTCGAAGTAACCGTACGTGTGTGGCACCTGCGGGATCTCGCCCAGCGGGACCATGAGCGGCTCCATGTCGTTCTTG
GGTTCGTACTCGGGTCCTCGCTGAGTCGTCACGAGGCGCGGGTAGCCTGGCTGAACGTTGTACACGTGGCGCATCGCTCCTTGGTCGTGGTCCTGAGCTG
GAACGCGCACCATCCGCAGATCGGCAGCGCCGAACCCCGCGTCGTCCGTGTGTGCCACCAACGTGGAGCCGTCGACAGTGGCGTTGCGTCCCACAGCGAT
CATGGTGCATGCTCTCGCCGTCGGAAGCAGCGCAACTCCGAGCAGCAACAGCCTCAGCTTCGACATTTCCGCTCAGTGGAAAGAAGGCTTGTGCTTTTTG
AAGAACACTTGAAGAGGTGCCGCTGGCAACGGATCAGTCTGCGTGAAGTCCCGTAATTAGACAGTTCTGAGTCCCGTATTCAGTCGAAAATGGGGTCGAA
AAATTTAGGAAAGGTAGGTTCTGTATAAATAATGTTTGCTGGGGTTGAGTACCATAAAATACACACGACGGACACTTAGGCCATGAGGCGGGGTCGGATG
GGGCCGATGGCTGCGTACGGAAGCGCGCTCGAGAGCGACAGCTCGCGGATGGACGGCAGCTTGAAGCCGCTGTTCACTTTCCGGGTGGGGGAAAGCACTG
GCAGACTGAAGGCCGGGGCCGAGTGCATGGGCGGAGACATCACATGGGGATGATAGTGCACTGGCGAGGCCACAGCTGGCTGAGAGATCGCGCCCGGCCG
CGGCAGAATGGGTTTGCACTTCTCGCCAGCAGCGACGTTGGAAGTCGCCACCGCCGTGCGCTTGGCCGGCTGCTCCTCGTCGGAAGACGCTTTGCGCTTG
CGCGACTTCTTGCTCTGGCGCTTGACCAGAGACATCTCGCTGTAGTTGTCGCGCGTGAAGTGCTCGCGGCTGTAGGTGGGGAACTGCGCGCGGGCCTTGC
TCCACTTGCGGAAGCCGAAGTAGTTGAGCTGGCGCTGGAAGCTCGAGAAGTTTTTGTTCTTAAAGTACTTGGGCAGGATCTGGGCGGTCATGGCTTCCTT
GTCCAGGATCTGGAAGGCCATGCCGTCGTCGGCCCAGCGGATGATCTTGGCGTCCTCGCGCCGCAGCATCTGGTGCAGGTGCAGCAGGAAAGGGGCCACC
CAGCCGCGCTTTGGGACCTCCTCGCTGGAGGACGCGCTACTCGTGCTGGAGCAGCTAGCCACTGACGTCGCGGGCGACGGCGGGCATACGGCGGTCTCGG
CGGAAAGCAAGTCTTGGACGTTCATCACAGTAGGAAGAATCGACGCGTGTGCTCTAAAGGGCGAAATCGGAAATGAGACTTGGCAAGCGTTCGGGGTGCG
TGTTTCTGCCTTGCCAACCGAGGCCCATAGTAAATCGCTATAGTTTTTCTTTTTTTGAATCCAGATTCTCCGGAGGCGGATGCATTTGGGGATTGTATGC
ACTCAACCTCACGCGAATCTTTATGAGGGTAGGG