Description :
From Genome Similarity Track
Location :
Scaffold_25:158715- 160196
Transcript NameFunction/comments
Phyra_77523sel-1 suppressor of lin-12-like precursor

Sequence
1481 bases(100 bases per row)
AGCTTGAACTGCAGTAGCACCATGACAATGCGTAAGGACGGCTCCTTTTCACCCGCAAGGTGATAGTAAAGCGTAGCTCGCTCTGGCGAAATGAACGACA
CCCCGAGACCATGCTCGTGCATGTACCCCACACTGAAAAGCGCTCGCGCGCTTGTGCCAGCACTCACCAGGTCTGCATGTTGATAGTGCCTTAGCGCAAC
AGTATAGTCTTCATCTTGGTAAGCACTGTCACCCATACGCAACAGCGCGTCAATGCTGTCTTGCTCAAAGGCACGATTCACAAGTCGAGCATATAAGCGT
TCAAGCAGCTTTGAGTCACGGATAGAGGGAGTGCCAAATACTTGTCGCTGAACACGTTCAATCAGCCAGACAGCATTGTTCTGCGCGACTTCATAACCCA
TTTCAGCAGCAATCAAGTACAGCTCCAGCGCTAGCGCCCAGTTGCCTCGTTGCGCGTGGGTCAGCGCTTGTGTCATCAATGTTGTTCCTTCTCGTGAGTA
TTCGGCCACGCGCTTATAGAGCTCAACAACTTCTTGACACGATGTACTGCTCGTGGTTGCACCTCCAATGGTGTGAATCTGCCGCTGCTTGAGTCGAGCA
AGCTGGAAAAGCGACTTGAGATGGCCAACGTGTGCCGCCGCAACGAGATACTCTTTTGCCCGTGACGAAAGGTGAGACCCGAGCTCCAAGAAAGACATGC
CCGTATTGTAGACACCTTCGGCATGACCTGCGTTAGCTGCAACTTTGAAAAGGTTGCGAGCTCTGTCAGGATCGACAGGCATGTCACCAATGCCGCGCGA
GAAAATAACACCGAGGCCATTTGCTGCTTCACCGCTAGGATTTCCTTCCGATGCGTTCAATGCAGCTTCGTAGAGCTCTACAGCTCGTGAGGCGTTGGAT
TTGCACCCTGCAAGTCCGTAGGCGTACACGTGACCGAGAAGAGCCTGAGCCTTGATGCTGCCCATTTCAATTGAGCGCTCCAGAAATCGTAGTGCCTCAC
GTTCACGAGCAGCGTGTTCTTCAAGATCAGACATAGCTGTAACACCGTACAGGTCGCTGAACAAGGTGATGCTAGCCGACTGAACCATCACGTCGGTGTT
GCGGAGGTCAGCAGCACGCTGTCTAAGATACTCAGCTCTGTTGAAGTCTTCTGCCGGGTTGAGATCGCCATGATATCGGGCACCCTCGGTCTCGGAAAGC
CTTGCAGGTTCAGGAAAGGCATACAGCTGAAGCTTCTGGTCATTCTGCTGGGTAACGACTCGATCCGCGGCGAGCTTGTAGTGCCTCATAGCTGCCGTAC
AGGACTTCCTTGAGCCGTAGCCGTGTAAGGCGCGATAACCAAGCGCCATGGAAGCACCGATCGATTGTCCACGAGTAGCAAACGCGTAGTATAATTGAGC
ACCTGCACTGTCATCAGAGGCAGCTCGCAGAGCACCTAGGAGGAACTGTGCTTGGGAACTGCCGTGCCCAGCACTAGCTTG