Description :
From Genome Similarity Track
Location :
Scaffold_2342:1587- 3901
Transcript NameFunction/comments
Phyta_totarag14393hypothetical protein PHYSODRAFT_256819

Sequence
2314 bases(100 bases per row)
GCATGTACATGCATTTACAGAGCGACGTTCCTTTGATGACCTGAAGCTGCCAGAAATCACATGTCTAAAACCGAGATAAATGTTAATTGTTGCCTTGTAG
GTCGTAGCTCAATAAAAACGCAGCACGGACCAACAAGATGGATTTTCCACCTAAGGGTCTATCTCGATTGTATAGTTCTCGGAGTCGTTTATCAAGTAAA
CCAATTGTTTTGCCTTGAACATCGATATTtcgtcaacaacaacgaggATAACACTCGGACNTGCCGTCAAGAACGGTTTTCACAACAGCGAACTGCTCAT
TCGACAACTCACACGGAGCAATCAACGATTCTTGGCCAAGCGTGTCAGATATGCTACCTACGCCATTGGTTTGCATTGGTTCTCCCACATTATCGTCATT
ATTATAATCTTGAAATTCGAAAGTCTGAATTGAAGTAGCAATCTTGTCCGTGGCATCCAGACATATCTGAAGCTGGAAATATTGGATTCTGTAACGAGGG
TAAAGTAGGTGCTGTTGAGGTCTCTTCATCTGTTGCAGTATCCTCCACGATTTTCTCTAAATACGGCTCCGAAAGTCGATTTTACTGACGCGATGCCTGC
TCGTCTTGTAGCCGACCCGATCGCAGCACGCGTAAGCAACTCATACAAATCCCCACTTGATGATATTACCCCATAAAATTCGGAGTCGCCGTTGTATGAT
GTTCCGGTGCGGACTCGTTTTATACGAGCCGGAGTAGCTTCCCAGTAATCAGCTCCCCGATTTCTCCAATCGGTAGCAATTTGTTCGTTGGTACTGTTCC
GATGTCCTTTTTTCATTACGTTTCGGATATACCGACAACGCTCCCTGTTTATCAATGGTGTCGAACTGCGGTCCCATGCATCACACGTACTAAGTAAtcc
tgctgcatcgagtgACCATTTCGGACCTCTTGAATCCCACTCCGTGAATGTACACAACAAATAACGACCTAAGCTATCACGTTTTTTTCTCGTCGCGCGC
ACTTTCAACGGAATTACTCcatgttggtggtggagctcccCCAAATGTAGCAGTTAACATCTTCGCTCGTATAAACCCGTGATGGGTCTTGAATTGTGGG
TGTGACGAGGCAAAAGAGAAACCATATCTAGTTGGTCTCCCACGACACGTCTTCTTGGTTTCAGCCTGCTTCTTTATCGGAAGAATGTCCACTATACACT
CAAACTCTAACGGGAAAATTCNGTGGTCAGCATCCCAGTTTCCACCGCGTAACTTCTTCACATACTCAACAAGTGGATATGGAAATACATACCAAAACGA
GTCGCTTGAAATAAATGATCGATGTCCGGTTATAGCGTGAACCATTAATGTGTATGACCACTCATGCGCTCCGGAGAAGCTGTTCACGGTTCTCGCTGCT
AAATAGTTGCCAATACGTAGCTCCGACTGTGAATCATCTGCTCGACTTGGAAATTTTAATTATGAATTGCTGCACTTAACAACGCAGAAGCTGCCCCCTT
AAGTGGAGCGTCTTCTTTTGTCATATAAGCTTGCTGATATTCCTCAATCCTATCCCCCGAATCTTCACCGTTAATCACCGACGCGTTCGTATGCTCGCAT
GTCAGTGCCGTAAGAACAAGATTGGTTTCTACCATCTTATTATCCACTATAGGCCGCTCAAGTTCCCACAATAAAGGCCCTTCACAATGCTGGTGAAAGG
CTTCGCTGGTCAAGTATGAATATCCTTTGTCAATAATCCGGAGGACGTGAGCTTGCAGTGTGTGACCTGCGACAATAGGGTGGGAACCGGTGCGTGTGTT
CCCCTTACGTTCACGCACGACCATTAGAGGACAGGTGGCACTATTGTGGACTCCTGACGGCCTAGCTAAGCGGCACATATACTTTCCACGTTTCCTTTGA
AGCAGGTAGATGTGTGAATGGAAGTTTGTTGTGGCCACATGCATCTGCGCAGCAGTAACAAAACCAGCGAAATTGAATCCAGCATCGGGTAGTGAAATTT
GGAATGCTTTTGGCAGTACACCAGCTTGAGACAGACATTTTCCCCTCCATNGTTCGCATGAAATTCTCGTGTCGCTAGCACTTTTACAGAGTAAAATATC
GCTGTATAGTTGTCTCACACACCTTTCAAATACGCGGACTGATAGAGCAGGATATATATTGGAAACAACTAATCTGCACCGAACACTCGATCGAACATAA
TCTGGTAAATCCTCTTGGCAGCATTGTTTTTGTTGAAAAATAACGTCAGTACGATTCCACGCCTTTAGGTCACGTAGTGCAGCGATACGATGCAATTCAA
GATCATAATGCTCG