Description :
From Genome Similarity Track
Location :
Scaffold_519:15869- 20654
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_519-snap-gene-0.16Inositol polyphosphate multikinase

Sequence
4785 bases(100 bases per row)
GATGAGCGTTGTGATACCGAGAAGTACACCTTCATCACGGCgAGGGgTCgAATCGACGTGCTGCACGTGGGCAAAGTCGATGAGACGAATGTCTGGATTA
CCATCCTGAGACGCGGAAGAGTCGACGCCATCATAGAGGAAGAGGAGGGAGCTTGCGATGAACTCGAGTTTCTCTTGGGATTCGAACCAGTGACGGAAGA
GCTCCAAGCGAGCAAGGAACTAATACACATCAGTGAGTCAGTCCCAATTGAAACGATGCACAGTTCGACTGGTGGTATTTGGAGCGTACCGCTTGCAGCA
GCCGTCTCGTTTTGGTGGCATCGTCGGAAGGAAAAAaCTTGGAAAAGAGCTCAACCAGCTCTTCCGGTTTCGTGATGGCACGGCCGACGTGCTTGTCGTA
CTCAACGTACACTTTCTGAGCAGATTCGTAAACTTTGATGCCTTGTACACGGAAACCAACGCTCGTCTGCAGCGGGAATTTGCTCTGCTCATAAGCGATC
TTCTCGGGGCTTGCTCCATCCTCGTACGATCTGGTGCCGACTTTGACGTCCATGATGCACGGCCACTGACGCCCATGCGTCAGATCGTCTAGCACAAGAT
ACTCTACACAACACCTTCAAACTAAGTCCTAGATCCACTCCTCCCAGTGGAGTCAAGCTACGTACTTCCAGCGTGAAGCGCTCCCGGCTCCTTCCCGTCC
TCGTCCACAACTACAAGCCCGCCGTATCTAGGAAGCAGCTGTCGCAGTTGCTCGTACACAGCGCTTCCCTGGGTCGAATCATCTCTAAATACATGCTGAT
AGAATTGATACTCGCGTTCCCCTCGTTGTTTGCTCTGAAAGGGCTTGAGGATCTTTCCTCCATGCGCACGCAGACCTTCCATGTTGAATGCACACAACTT
GGTCAATATCGACTCGATTAACACCAGACCGCTGCGCACCCACTGCACATAGACTACATACTCGTTTTAGTAGTAGCATGGCCTCCCACTTGGTGGTCCA
TGGTCACGAACTTGGTCGCATCGACCGCATCATTCGGATCCGTCATTACTCTCGTGTCTCTCGATCTCGTCTGTTGTCACCGCCTCAGATCCGAGTTCTG
ATCGGCTCAGGTACGATTTCTGATCGGCTCAGTCCTCAAGACACAAGACATCATGCGTGTCCTTGTGCTTGGCGGCACGAGCTACGTGGCGCAGTTCCTC
CTCCAGCGCCTCCTTCATGAAGCTCACGGTCCTGCAATGGAGCTCGCATGCACCATACGTGCTCCATGTGGCTCTGAGCTGCCCTCTGGTTTCGTCCATG
CCGATGCACAGTGCTCCGACACCCGCGTCATACGCGTGTTCCATGGCGTAAGTCTGCTCGACATGGACTCTGTTCGTCGCTCCATTGAGGCGTTTGATCC
CCACGTCATCGTCAACTGCATTGGTGCGTTTGTGCGATGGGCGCATTCGTGTGTTGTCCCTATTGAACCCTCTTGTGCAGCCATGTCGTCGCCTGCAGCG
TGTGAGAAGAACCCCGACTTAGCCACTGCCTTGAACGAGGTGATGCCGATCATTGCTCTCGCCCATTCGATGATAATGACAATGCAATGCAGCCTGTCGA
TCTCGTGTCGTATCTCGATTCGTACGCGGAAACGCAAGGGCGCACACTGCGATACATTCATTTCTCGACGGTACGTCCCATGAGAGAGAGCGTGGTCCCC
TGAACGTCATCTCAGAAACTGTGATCCTATCGACAGGATTTCGTGTACGATGGTATCCACCCACCAAGCACGGGCTATCGTGAGCAGGACGCCGTCCTCA
GCCCACGTCAGTGTGTCTACAGTGCCACGAAGCTACGCTTTGACAACTTGTTGATGCAGAATCGACCACCAAACCTCAGTGTCGTCGTGCTTCGTATTGC
CAATGTCGTAGGTCCCAGGGCGCCATTCTTCGTTGACCACGGCACGAAGTTTGCCGAGTGGCTGTACAACGAAGTCTTCCTTTCGCCTGAGAAGCTGTCG
GTTCCGGTGCGACTCTGGAGTGATGAGGTGCGCTGTTTCGTCTACGTCCACGACCTCGCTTGGGTCATCGACAAGCTGTTTTCTTCCCCGTGTGAGGCTG
CCGTGGAGCTTTTCAACGTCGGTATGTTGTACGGTGCGCATGAAATCATTCAGCGCCATCTGATGAGTGTCTTAGGGGGGATGGAGGCGCTTTCTCGCGT
TGCCTTTGCGGAGCGTTTCCTGGAGACGTTCGATGCGACTCGGACCCATCGTGAAATCGAGCCAACACAGCGTGCGCTCGTGGATCTTGGATACCAACCA
CCCCTTGACGCACGCCTCGACTCCTCCAAGATTCTCAAAGCGCTCCAAGACTTTCAATTCTCAACAACCGACGACATCCTCCTGCATCTGCATCGAGAGT
TTGAGAAACGCAGTTCAAACTGATCAACCTTCCACTGTTTAAGTTTCATTCAAAATGTTCATAAAGAGAAGTACTGAGAGAGAGAAAAAGAGTTACTACG
TAGCAAGAAGCGACGCTTCATCCAGCCAGTAGGATCTTAGACCTTCACGgCcATGATCTCCGCAATCTCCTTCTTTGGCGATGGGTTCACGAAAGCAGCG
TCACACAAGCTAAGCGCATGGCAGGCCTGGCTTGGACTCTTTCCTTCACCAATGAGCTGAATGAGATCGTCGAACTTGGACGAGATCACGTCACACTTGG
CGTTTGGAGGCAGCACAACGCACATCGTCTGCAGAGTCTTACGTGCAAAGCGCGTCTCTGACTCACTTCCGTGGACACGTGTGAGCACTTCAGCAGTGTA
CTCACACAGCAAGCAGCCCATTGACATGGACTTCGGGGTATCAACGGCCTTCGCCTTCGCCTTTGTCATCGCGTCGATTCGGTCGAGCTTTGCAGCAGAC
AGAGGCATCATCTTGGACTCGGTAAGTAGCGACGATTCACAGAACTTGAGCCCCTTGCACACTTCATGTGGTGACTTACCGCTCCTCAACTCCTTGACAG
CCTTGTCAAACATCTTCAGGTCgTTATGACACTAACACGGAGACAAGTGAGAACACGTACTTTGCCTCCGCCTTCTAACGTTGTCTTACCTTGTCGTCAG
CAGGCATGAAGTCACAGACGATTCCAGCAGCTTCACGAATCTGTTCGACCTGCTCTGGTTTCGACTTGAGAGCGTACTCCAGCACAATCGCGACACCATC
GCAGAAAGCACAATTGTTGCCCCCTGTTGATAACTTCTTCGGCAATGGAAATGGCAGAGTTGCCTTAGGACAGAAATGCATGTCACGGCAAATGCTGCCA
GGCTCCTGACCCTTCGTAATGGAGTCAATAATATGATCGATCTTCTGAATAACATCGTGGCACTAAGTCCAAAAaTCGGTTAGCAGGGCAATGTCAACTT
CAACAACCATGTACACTCACCTTGTTGTCCGCTGATAATACGTTGCAAATCATATCAGCAACCATACGGATTTCCGACACCTGCTCCGGATCTTGTCCGA
TCGCAACCTTGAAtAGGTTCGCGATCTGAGTGCaGAAAAAGCAGTCATCGATCAGTTTCAGGTTCGACGCGATCCCAGTCGACTTGCTGACCACATGCTC
GAGTTGAGGTGACATGTCGACACCTTCTGGAAGCGCCGGAAGCGACTTTGCATTGCACAACTTCATCTCTGTGCAAATCTGACGCGGCTTCTTCCCCTTC
TTCAGAGCGTCGACGACATAATCCAGGTTGTCGACATACTGATGACAAGTGCTCTGTTCGCCCAGCATGCCGCACACAACATCAGCGTACAATCGGATCG
CCTCAATATCGTCATCGTCCTCCTGAAGAGCGACTTGGATGAGGGTCACGAAGTAATCGCAGTAGAAGCACTTCTTGTCATCACGAAGAACCATGGCCGT
GCTCGCTGGTGCAGCAGACTTCTTAGAACAGAACTTCAGCTCAACACAAATTTTACGTGGTTTTTTtCCTtCATTGATAGCGTGCACGACGAAGTCAAGT
TTGTCGACGTACTGATGGCACACGTTGTCATCGCCGAGCATTCCACAAATCATGTCAGCGTACTGGCGAATTTCTTCAACGgCATCTGGgTTCTCCTGAA
TCGCAACTTCAATGAGGGTAGTAAAATAGTCGCAATAGAAGCACTTCTTGTCATCAGTAAGGGCCAGCGTAGAAGCCGCCAGATTGATCGTCTCAGCCGC
CGTCTTTGGAAGAACTTTCACGTTCTTCTTCGCGGCGCAAAACTTCATCTGCGTGCAGATGtCCCGCGGCTTCTTGCCGTTCTTCAGACCATCAATAGCG
TAATCCAACTTGTCGACGTATTTGTGGCACACGCTGTTTtCCCCGAGCATTCCACAAATCATGTCTGCGTACTCTCGGATTGTGTCCAGACTCGTCTCGT
CTTGCTGCATGGCAACCTCAAGAAGAGTCAAGGCATAGTCACAGTAGAAGCACGTCTTTTCATCTGCTGGAGGAGTCGCGAGGACAAGTGCCGACATTGC
CTCGGCCATCTCAAGCTTGCCAACCAGTTCCAGCAGCTTCGACTTCTCCGACTCCTTCCCACATAAaCCAATGGTGACGCAAATCTCCTTCGGTCGTTTG
CCTTTGTGCGTCAAGTCGACGATCTTGTCGAAGTTCTTCTCGGCCTCATCGCACTTGCAACTCTTTGGAGTGAGCTTGCACACGTACTTGAGAATCGTGC
GCAGGTTGTCGAGCTGTCCAGGCGCGTTCTTGGCAACGAAGCCCACCACTGACGAGATCTGCACGCAGTAGAAGCACCCGTGGCG