Description :
From Genome Similarity Track
Location :
Scaffold_328:15869- 17502
Sequence
1633 bases(100 bases per row)
TCCAGCTGACTTGTGACTCGTAACTTCTGAGCCACGGTAACCAAGGATAACATAAAGTTTATCATCCAAGTCCAATACGATGAAGTCATCGTCATAGTGG
ACTTCTTTCAGTGTATAGGAAATCCCCTCTACATGTTCCATCACTGTAACGGATGGGCCTGTCGCGAGGCGTAACTTCATCTTCGTTGGAGGGATCTTGC
GCATAATAAATGTAAGCTTACTGGAATCTAGCTACTGGCATCACAAAAGTTTTCCGACGCCCCACAATCGACTAGGGCTCGTAGTGACATGTCTTTTACC
ACTTCGAGTTTCAAGGTAATGAAGGAAACCTCATTACCAGATGCAGTAACACACAATGATTGCGTATTGAGATCAATCCTCGTCAAGAGACCTGCAAATT
CATTTGACGTTGCTGGATTAGTAGGGTGCTCTGCACCTACTGAACCTGATCCTCTTTAGACTGTCCGTTACGGTGTTGCGCTTTCGCAGCAGCGTCGGAC
CCACGCCTCGGATTCTTCTTGGCCGCTTGACGGTTACTGCTTCCTGCGGTACGTGGTACCGCGTTCGGGGCACTGCACTCGTATGCATAATGCCCCTTCT
TTTGACATCTATTGCATCGCTGCAATTTATTATAACTGGTAACGCGAGAGCTTTCACTCTCAGCGTTACAGAGTTCCATCGGTTCTAGGCCTTCCTTTTT
CTGTTGCCTCGGAGGACGATATTAAGCCGAACTCACGTGAGCTTGTTTCACGCTGAAATCTTCCTGTTCCGCAACATGGATTGTCTCTTCCAGGGTACCA
AATCCTAGTCGGAAGAGGTAGGTCCTGACTGGACCATCTGCGACACTCCCTTCATGAACAACGTAATTACCGCTTGTTCATTCGTCGGATTGGCCGTGAC
GCAACTCGTAAGATGACGTATGTACTGAATAATGTATGAGTGTACATCACGTTAGCCTTGTTTGATTTACAGGATTTCAGAGCGATCCCTGAACCCAGCT
CGCGTTGGTTCGAATATTTGCCTGAGTAGGGACTTGAAGAATTCTAACGACCCAAATACATATGGGTCGTGTAGCTTGATGCCCAAGGCCCAAGTCTTCG
TACGTCCTGCCAAGTTCGTTTGAGAAAATGCGACCTCCATTTGCTAATCGACGATGTGGTGAGCCCTCACGGCGTCATCCAGTTCAACAAACCATCTCAA
CAGAGAGTTTTCATCAGCTCCTTTATACTTGGAGATATCTATCTTCATCGATTCGGGTCGACGTGTGTATGTCGACCCGGTAGAAGTAGCCTGCTGATGT
GTCGAAAGTTCGAAGTGTTGAGCATTCTGTTTTCTCAACAGCTCTTCGATTGAGATCCTTGTTGGTGAAGCAAGGCTACCTTTTCCCTTTCAGCGTCAAG
TTCATTCAGAATGAACTTGGCGGTGGTGGCGTGTTGCCCGTCTGGACCCAGAGCGGGCAGCATTGCACCTAAGGCTTCTTGCCCTACCGTCGAACTCAAG
CGTTCGACAGCATCCCACTCGATTTGATTCACATGGGACTAGCTCTCGTGCGTTGGATGAAAATCTTCCGCTTCATCACTTAACATGTTCATAGTCGTTG
AACGGACTACAAAGTGCTACCAGATGTAACGAG