Description :
From Genome Similarity Track
Location :
Scaffold_32:158632- 162713
Sequence
4081 bases(100 bases per row)
CCACTAGGAACAATTGACCATATTTGCTTCGTGGTTTCTAAACCCAGTACTGTGGATTGGGGGTGTCGGTGGCACGACAATACTACCACGCTCGCTGCAG
ATCGGATGAATCCCCGCTGGAATACCTGCATCGACTAAATGTGGCTGGTCTGCGGGCCAAGTTGAAGATCAAGGATGCGGGATCCAAGGTACTACGGGAA
CACGTGGATCATTTCATCGAGACGCTGGGAGATGCGGATCTGGTCGACAGGCTGACCCTGTTACGTCTTCCAGACGCGGATGAGCTTGAAGAAGTGATTA
GGGCTGTGGAGCGCGTGAAACACCGCCAAAAGAAGGCGGCGAACAGATCCGGCAAGTATCGCCAAAAAGCTCCGACACCCACGGCCCCAGCTCCACGTGT
CCACCAAGTCACAGCGCCCGACTCAGGAACTGAATCGGGATCTGATGGCTCGGACTCCGATCCAAAGGATTAACGCAGAGTATGTCTCACTGCGCCCAAC
GATCGTACGGCAAAGACTGGAGAAAACTCTCGCACTAGTGATACCGTCCCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGACAGGAC
CAATCAGGTGCTCGCAGTGTAGATCCCGGAAGCACACAGAAGCTGGATGTTGGAAACATCTGGTTTGGGAGAAGTGTGTCAAGAAGGGTCATCCCGGGGA
TCACTGCTTCTACGTGTGTCGCGTTTGTGGCGAGATCCACGACGCCGGTAAGTGCCCGATGGAAGAGTTCTACAGCCAGATCCGCCAATGGTTTGATCCA
GCCAAGCACAGAGTTATGTTGCCAGAAGTGGCAGAGAAGATGTTACACTAGGACGCTCGCCAGGTTTGAATCCGGTACGAGCCGAGCGGTCTAGCTACCG
CATTTTTGCATTTGTGAGCAAGACGTCGCTAGATCCAGGTAGCAGGCTCCTAGTTCCAGTCGATAATACACGTGATCGACATGAAGTGTTAGTTGCCAAG
GTCTCTAGCTTACGCCGCGTGGACGAACTGGCCTAATCCGACGGTTTTTTTAACCTTGGATCTACAAAGGGGAGAAGCACGCGGTATTGGAAGAACCAGC
GACATGGCCAATGGTTTGAGTCCAACAAGTTCGATATTTGGGTCGGAGTTCTCGCTGGCCAAGACGCTATTTTTGGAATGATTTTCCTGGTACTAGTCGA
GGTAAGGTTGGATCTGGCAGATGGGATGTTGTGCTTCCCAGATGAGATGCGGATCCATCTCAGTGAACGTTGACCGTTGTACGGGGCGAAGACGATATTC
ATTAGGGCAGTCAAAACGGCCTGGATTGAGCCGGGGAAACCTGGTAATTGCCGGATCGAATGAAATGGGTGGAATATGAGAAGCTGTGGGTCACTCGAGG
CGAGAAGTGGGTGCATACAGTTATCCAAGGACCTGGTCGATCGCAGTACCGCCACTTTTACGAATGTCAGTGACAAGAGGTCATTACTAGATCACTATGA
GGGAATTGGACGATGGCTGGCAAAGGATGGTATCCCTAGGCGACCTAGGGTTGCGTCAGTTGGATCTCGTCGTTATAGAGAACGCCAGAATCCAGCGTAT
GAAGGAGCTACCGAGACTGAAACCTCGGGAAGGTAGAGGCTTCGACGGAGCCTACCGGCCCCTTGGTGGACCGACCTTCATATCCAACCCTGCGGAAAAG
CCTACAAAGAGGTCGTCGGACTGGGATCCAAGTGGTGGAGGCTGGATCTGAGACAGCAGGAGATACCCGGAGCCAGTCACCCAGGTAACCAGGGGTCGAT
GGATGATGGATCTCAGGTGATTGAAGCCGGCCCGTTGGATCCCACGAATCCGCACCTAGATCCAAACTCTCGATTGAACAGAATGCCTGTATCACTCTTG
AGAGTGTCGGCACTAGTTAAACTGGAGCCGTCATACGTAAGCACACCAGAAGACCAAGTCGGTCCAGTGGGCAATTTCCCAGGTACCAGAATATTCGATT
GAGTAAAAGCAGAAAAGCCAACTGAAGAAGGGAAATCGTGGTGTCTGGATCCAGTGGTGGGTCCGACAAAGACTGAGGATGAACAGGTATGTTACCATGA
AGGTGGGGGTCTGCACGCCGAAGAGCTTGGGGAAGATATGGCGGTAATCCCAGAGGTGTCACTGACCACAGAGGAAGTCACGATTGACGATGTCCAGGTG
GATCCGGGAGCGAACGAACCCGCGGAAGTGGGCCGAATGCGTCAGAAAATATGGGAAACCGACATCTGCTGATTGGCAAAGGTACTGCATTACCGCCAGC
CGCACGTGGAGTCAAATGTGATATCGATGTCGGCGACGCGAAGACGATTGCTCAAATGGTACGCAAGGTGGCACCCCAGTTCCTTGAAAAGCTATCAGAT
CTGATTTAAGGTCTGTTGCGAGCCAAGATCATCCGTTTCTCAACCTCCCCGTGGGCGTCTCCTGTGGTGATCATTATTAAGAAGAACGGGGTGGATATAC
ACGTCTGTGTATTAATTACCAGGTGGTTAACGGTCTGACCAGACTGATGGTGTATCCGATGCCTCTAATTAATGAGCTATTGAAGGATTTGGATAAAGTA
CTCTGGTACTGCTCTTTAGACATGACGAGTGGATTTTGGGTGGTAATTATAACGGATCGACCTCATTCAATATCCGCATTTATTACACCATTTGGACTGT
TCGAATGGAACCGGATGCCGTTTGGATTGTAGAATGCACCCCAGATCTATCAATGTTTGATTGATAATGCCCTCTACGGTTTACTCGAATCCCGGAACCC
AAAGGGGGTGGGTCCGGAGAAGGTAAAGCGGAAGTAGATCCATTCGAAGCAGGCGAGCCAGGCGATCTGGGGACACCATCCGTGTTAGGGCGAGAGTTTA
ATATCGACGACATTCTAATCTCGGCGGAATCGTGGGATCAGCTACGCGAGAGCGTAAAATCCCTACTGGAGGCGTGCAATAAGTGGAAACTCTCTATCAG
CGTGGTGAAGAGTTATTGGGGAATGCGAAAGGTGAATTATTTGGGTAATCGGTGTTTCCAGAGAGGGATTGGAGGCGAATCCAAAAGATCTGTCTTAATT
GGCAGATTTATCTTTCCGCATTCGCTACGGGTGATGCATCCGTCTTGGGCAGTTTGAATTACTACAGTCGGTTCATTCAGGATTATGCACTTTTCGCCGC
AGCCTTCTATGAATTAGGGAGGTGGACTTTGCTGCAATTGCTACTTCGGCTGTCCGGACCAAGTTCCAGCAAGCTCTGGCCCTGGAGATCCTGGAGCCTC
AAGGGGATCCACTTGGCACCACGTTGGGAGGCGACCTAAAGTAGGAACCGGATCCACCCCGGTACCCCGTGGGAGAGGATCCGACCCTGACTCAATTGGC
AAAAAAGATTAGGACGAAGTGCAGCCCCGGTGGATCCGAGCTTACCATGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCCAGCAATGATGAAGAAATTACAACACCACATGAGCGTCTGGTCAAGCTGCTTTGTGTGTGTTATGCCTGCCGGTGGGCTCGAAGC
CTACTAGCGAGGGTTCTTCTGGCAAGACCAACCGACTGTGTGTATTTTGGCCGATTATATACTGGAATGCTTACGTGACGGCTTTAGCTTGCCTACTTGC
ACGACAGGGAGTGCGTGTTGCCTGCCATATATACTTCCAACCGAGTGTTGAACGCTCAGTGTCCTAGTAAAAGGCTTACCCGTGCCTGGTACACTTCCGC
TGATTAGGGTTCATAACCCCTGCTAGCTTTGAGCGTGCTGGTGTGGTGTACTAGGATCCGCAAAATCTGCGAAAATGCTGGATTCTACTTCCCACCAGTA
CCCAGACACCGACTAACAAAGAGGGCCCCCCGATGATCCGTGATCTGCCGAACTATTCTCTTCTTGTTTACCCCGGGATCT