Description :
From Genome Similarity Track
Location :
Scaffold_165:15862- 27488
Transcript NameFunction/comments
Physo_144078hypothetical protein
Physo_144079ankyrin repeat protein E4_2
Physo_144080hypothetical protein

Sequence
11626 bases(100 bases per row)
AACCAGGCAGTCGTGTTGATGAGCAAAATATGCAGTAAGTATTCCATCTAACCTTACACAGAGTTCTTGCGCTGGAAGCTCGCGTTCGAGTTGTCAGGGT
CCGATCGGTCGCCACTCAGGCTTTCGTCCTCTGTCATGCCCACCTGCACCGAGTTGAGCGGAGCCGCCTGGGCAGGCAGCGCATCGCTCGAGTGGAGCGG
CACCGCGCCGTCGTTGGCGTCACTGGAGACGTCAACTCCGTAGAAGTCGTAGATGGTCTTGACCGTGACCTCCGAGTCCTTGCTGTTGATGTCCTTGTGG
TAGGCCTCGAGCACGAGCCAGAAGAGCGGCACGATGTACAGCGCCGAGAACACGTCGAGAGTGTAGTGCTTGCGCGAGGCCACAATGAGGAACGCAATGA
TGATCTGCACGCACACCATGATCGTGATGCCGTACTTGTTGGGCCAGTACTTCCAGATCGTCAGGATGAGCGACACAGTGTAGATGGTGTGCGAGCTGAA
CATGAGGTCACCGCAGCCGGTGAGCGAGTCGAGACGCGTGAACAGCTCGCCTATCGTCGGCGGGTTGAAGTCCGGGTTGGGGATGACGCAGGGCACCGGG
TCGTCCGGGTTCGCGGCCAAGCACGTCTCGTTGAACTTGAGCTCACAGTGGTCGGCGGGGGACGGCAGCGCCGTCACGAGGAACGAGATGCAGCGGAAGA
CCAGGCAGATGCTCAGCTGCAGCAGGCAGCGCTTGAGCACGATGACGAGGTAGCGCGGGCGGCCGGGCTCCTGGCGGAAGAGCGGGATCGTCAGCACCAG
GACGATGGCTGGGCCGAAGACAGCCGCGAACACCAGGATGTCCGAGATGGAGGCGGCGAAGCCCGTGAGCTCCGACATGAGCTCGTAGCCGAGGTCATGC
AGCGTGAAGCGCTGCTCCACCGTGAGGTAGTTGCCCTGGATGTAGTAGGCCAGGTTGTGGAAGATGGCGTGGACGTACTGCATGATGACGCAGGGCAGGA
TAATCTTCCACTCCTGCTTGAGCAGCTGGATCTCGATCTTCACATAGTTAATGAAGCTCTCCTTGTCGCGGAGCTGCCAGACCCTGCCCATGGTGGACCG
CCGAGTCGGAAGAGGAGAAGGAAGCGCTGGTGCTGCTTGACTGGGAATGGGGTAGCGTAGCGAGTGCTGCGCTGGGATCAGACGGAACTGTACATAAGAG
AGAAGAGGTCGGCGGAAGCGGTGAGTGTCGGAGGCGAGCGTTTTGCTGGGGGCTTTCAGGGGCGAGCAAACACGAACGTACCTCGGCACTGTGCGCTGCG
TGCTGGCCGATTATCGAGTGGAGAGCCCCGGGAGTCTCGCAGTCGCGCTTGGCCTCCTCTTCTGTGTGTGGAACGGCGACGTCCGCGGTTGGCCTGCTGT
TGTGTTGTGAGTGCTCGGTCAAAGACGGGCACGGTTGATTGCGGCCTAATTACAATGACTTCAAACATTTAATAGTGGGATGAAATGATAGTACCGACGT
CCTATTTGTTGCATCTATCTTTGTCCTGTGCTATTTTTATCCCCCAGTGAATCCGATGGGGGCGATATATAGAGGGAAATAGTGATTGCGCACTCGGGCG
ATCAGTTGGAGCAGATGACAACCAACGTCGCAGTCGTCCTTCGCAGCACGGCAAACCTTCACTTCACTTTGCTCGACTCGAGGTTGCGCCCGGTGGATAC
CTGCACCTGCGGCCTGCACGAGCGTCGCTCTCGGGGAGCCATGTCGCTGCTTGAGGTTGGTCTCCACCGAGTCCACTCCAGTCGAAACGCTCTCGGCCCT
CGGAGCCTAATGATAGCGCTGGGTCGGTTTCGAGCGAGCAGAGCGCTAGCGGCTGGATTTTCCTCCGCCATGGAGCTACTGCAGCGGCCGTGAGACTCCA
TGAAGCGACTGAGCAGTTCTTCGCCGCAGGGTGTCGCCGAACAGGAGCGGGGCGCGCACCTCCAGCTCGCGCAGCGCCACCGGAAGATCGTCGCCGGCAG
CTTCAAGGGCCGCAAGGCGCTCGAGCCCGAGTTCTCCACGCCTGGCGTCGTGGGCAAGCTCGCGCTGAGCTTTACGACCACTGGGCCGCTGGCCAAGCAC
ACCCGGATCACGTGCCAACTGCCCGACCACGGGTGGACGCTGCCCACAGGTTCATCGCCCAATGTCGTGCTACAACTGCCGTCCCCGAATGAGCACGCGA
CCACTGCGGCGCTGCCCCAAGTTAAGATGACGTGGAGTGCTCCGACCCGGACGATGGAGTTTACGTTGCTGAACGAGAGTGTGATCCCTGCAGATACGCC
TCTGGTGTTGGTGGTGTCTGGTGTGGGCACTCCAGAGAAAGCGACGCCGCAAGGCGAAGCCATTGTCACGACTTTCGAGAAGCTGGTGGTCAGGAATACC
GTACCGACGTCCACGCGTGGCGGACAGATCATCGATGGACCAGCTGCGTTTACACTACCGAAGATCATGCCTGGGTCGATTGGTGGGGCGAAACGCTGGA
GCCCGTTTAATTGTTGCCCTGGGGCAGTCTCTGCTGTCACGCTAGCGTTCACTGTCAATGGCAAGATCCCTCAAGGTGGAAAGTTGCTGGTGGAGCTGCC
GCCGAACGGATGGGATATGGACGGACAGCCCAAAGTGCTGCTTCGCACTCCGGTGTATCATAACAAAGCGATCTCGGCGGCGTGGGACTGCAATCAGCAC
GCGCTGGAGATATATCTGGGTTCTGACGGAACATCAATTCCCACGAAGACGAACGTCATATTGACGATCGCTGACGTGAAGAACCCGAAGAAAGAGACGA
CGTTATCAACTCTAGCCAACGCAGCCAATGAGATGTCGGCCGCTGCACGTCTTACGACGCTCTCGGCAAGTGGTGGAGTAATCGATGGCCCCAGTCGAGT
CGAAGTGGCCCGCATTAGCAAACTCCGAGAGCAAGATTTTGAAGTTCTCACCAAAGTTCTTGACACAGATGCAGCGGAAAACCCAGCCAGCGAGGAGGAC
ATCGCTATTGCCACCGTTCCAGATATTTTGCGTCGGGCAGGTCTTACTCTCTCAAACGAGTTGTACCAGTCTCTCGTGGTGCCGTGCTTTCCCGTGCGCG
ACGCTCTCCCCAGCATTGACCAAAAGAACAACGAGCCCGCGTCTTCTGACACCGCTCGTTCAACTGCTTCGGATGCCACACCGAATGCACCAGCCGTTGA
CCGTCTTTCGCGAGAAGAGCTGCTTAATGTGTTTGCTCTAGTGTACGCTCCTGCGTACAAGTGCGGCCAGCAGCTTCGTTTGGCGTGTGGTCGAGGACAC
GTGGATCTTGTGCGAGAGTGGATAAGTCGCGGCTGCAATCCAAACGCCGGGGATGCTTCTGGCTGGTCCTCCCTGCATTACGCCGCGGACTACGGCCAGC
TCGAGGTGCTGAACTTGCTAGTCGAGATGGCATCCCCGCAACCAGAAGCTGACGGCACTGATGCTTCCGAGGCCATGACACTGGAGATCGACGCCCGCGA
CAGCCACGGCTGGACTCCGCTCATGTGTGCAGCTGCTAACGGCCACGTCGACGTCGTCGAGAGGCTGTTAGCACTCGGCGCAAGTGTCTCATCGACCAGT
ACCGAGCAACGCTCCGCTCTCCATTGGACTGCTATTCGAGGCATGCCCACCGCAGTCTCTGCGTTGCTAGCCGCTGGAGCAGACGTGAACCTCGTGGACC
GCTGCGGCTGGACGCCGCTGCACTGCGCAATGCTGCACGGCAACTCGAGCTGCTCCACCATTCTCATCGAGAAGGGAGCAGACCAAGCGGTGAAGGACAA
ACTGGACTACACACCCCAGTTCTACGGCGACGCAGCATTCCTACCCCACAATACAGGCACCACGTAAGAGCCCACTTCATGCGTGTCCGTCTTGTCTTTG
CTGCCTTTGACATGCTTCTCTCTCATTGGCTGAATATATGTCCATGTTTGCTCAATCAATTGAAACACCGGTAATTACGTATACCCTTTGATATCGCATT
TGCCTGGAACATGGTGTGTTGATCAAATCACCTGTGTCATTTAATTCCTCGCTTGAACCGACACTTGTATCCATATCGAATATGCGGTGCGGACACCGTG
CAAGCAACTTCACCACTCCACAAGAATCTTAGCAGCCCCAAGCAGCTCCGTCACAGCTCAGGGCCATTCCGCTTCCTGCCGCTGCTGTAGCATAGCAACC
ATGGCCACGTCCGTCGGAGCCAAAGTGCTGGCCGAGGTGTACCGCCTGCACCACATCCCGCTGCCGCCTATCACGCTGCAGGCGCTGCTGAAGCGCGGCC
CGAGCGCCAGCCCCGCCATCGCCGCGTCGCTGCAGAACGACCCGCAGGCGCTGGGGAAGTGGCGCGAGGCGAACGCGCCCGCCATCGTCACGTCCGCGCA
GCTGCTGCACCGCGAGGTGCCGATCCGCATCGCGCGCCGCATCGTGGACCTCGAGAACCTACCGGACGAGCTGCCGAGCGCCGAGCCCATCGTGTCGCTG
CGCGAGCAGCTCCTCAGCAGCTTCGACCAGCTCGTGAGCTGCCCGCTGCCCGCCAACCTCGCGGGCGAGCGCGAGTTCATCGAGCTGCACCAGAAGATCC
GCAAGGAGCACGCCTCCATGCACGGCAACATCGCCGAGGCGGTGCAGGCGCTCGAGTACGAGCCTCAGGGGCTCAGCGAGTCTCTCGACAACTTCTACAA
CTCGCGCATCAGCAACCGCCTGCTCGTGGACCAGCACCTGGCGGCGCAGACGCCCAAGTCCGGCTTCTCGGGCATCGTCAACGACGAGTGCTCGCCCGTC
AAGATCGCGCGGGACATTGTGCAGAAAGTGCGTCCGCTCTGGACCGAAAGCCTCAGCGGCGAGCAGCTCCCCGAGATCATTGTCAGCGGGGACGAAGACG
CCACCTACCGCTACGTGCCGCAGCACATCGAGATCATCCTCACGGAGGTGCTCAAGAACGCGGTGATCAACAGCGTCGCGGCGGCCAAGAGGACGGGCAG
CGCTCCGCCGCCTGTCAACGTGTTGATCTCCGGCGGACCGCATGGCGTGTGCCTCAAGGTGTCGGACCTCGGAGGCGGCATGACTCGCCAGGAAGCCAAC
GCGCTGTCGAACTACTACCACACGGCGACGTCCCCTCCTTCGAGCGGATACGACCCCATCGCCGAGATCCTGGAGAGACGTGCCAGCGGCCTGGACTTCT
CGGACTCGTTCGGCCTGCGCATCGCTCAGCTCTACGCCAAGTACTTCGGGGGCGAGCTGGCCATCATGCCCATGGAGGGCCACGGCGTGGACACTTATAT
TTACATGAACTGTCTCACGGGCGCCTCGGAGGTCAAGTAAATCGAGTAAGATAGGCCAATTCACCAGTGACACTGGCTGAGTGATCTGGAGGGTCCTGCA
GAATGGAGGAAAATAATGCTGTGTGCACGATCTGACTTGAAAAACACCATTACTATATAAACGCGTTCAAGCGTTTCTTGCCTAATTTACTCTAGTGTAA
TCCGTTTTCAGCTTGTGAATCGCCGAGATCGTCGCCCATGCACAGTATTCCGTTCCGGTTGTTTGTTGTGAACGAGTTGGATCTGCAAGATCCCCATCGA
AGTAAGCAATACATCGGACACCCACTCGGCGTCGTCGATGAATACGAGTGCCAGCCTCTGTGGAAATCTAAAGCGTAAGCGCGTCTACATGACTATGCTC
CGGTTCTTGTGATTCACTGACAGATCGATACCCCAGTGGCGCCACGTACCCGCAGGAGCTGGGGTTGATTCTGCTTTCAGGTCCACGCACAGCGATAAAG
TCTATTCGGTTGAGTGTGGATTGCACTCGGGCCCCATCCCAAAGTAAGTGAAGAAAATTAGTTTGCAAGCAAAACCTGAGCTAACTGCTCGCCTACGGTA
GTTGCCATCTTTACAGAACAGGGAGGCGGAAACGGACGTCGCTCTCTTGACGTGGTGTCTCGCTACTTCAGCACAGAATGGAAACCATGCTGGTAGAGTA
CTTTGCATGATAGCAATTTGGCGTCCTCACTAAAGTAGTTTGCATATTTCTCTGCAGCAAGCCTCTTGTCTGGGAAGCATGTTCGTCGGCAATGCTAAAC
ACAGTCGAAAAACTTGACAGGATGGCTTCCTTGGATATTCGCGAGTGCTCATTCCTCAAGCTTGTTATTCACGCACCCCACAAAAGCTCTCGCAACCAAT
CCCACCAGGTATCGCTGCATATTTCACCTCAAACTACATATACAACCCTGATTTTGCTAACTATTTCGCACCCAACAGGTTGCTCTGGAAAACATTGAGC
TGCTCGGGTTAGCCGAAGATTTAAATCTTTCACGGGCTGTACCTGGCGGCAACAATGATTCCAATCGTGTCTTTGGTCGCATCCACCGTCCCGAACTGCT
TCACCCCGCAGATGGCAACGATGAATTGCAAGACGTATTGCTAGATGCGGGCATCCCTATGGATCTTGTAGCTCGGCTTATAAGCATATCTGAAGCTAAA
ATGCCGGCTTTACCTCTCGAAGATTGCAAGTCACAAGTCGCTGACAACAGCGAAGCGGTTCCTGAATCGAGTTCTGAAGGCAAAACATCCGTGGCTCTTC
CTGGTAGTCCTTCTGCCGGCGTATTGGAAACAAACGACGACGACAGAGAAATTCCTTCACCGTTTGACTGTTTACTACGACAATATGTCGAACAAGCAGC
ACTGGAAAAAGCTGTGCTCGAGGATATTCTTGCTACAAAACTGTGTGAGCGCAAAGACGACGTATCCACCTGGCAAACTCCAACGATCTCCCCGACTGAT
CCTGCAAACACTGCCGAGATCACGCTGTATACATTTGGAGTTTTCTTCACGCAGTGCTTGCTTTGCGGTGGATCGGATATCCAAGTGATGTGTGTACAAA
TGGCGGAACGTTCTGCTCGATTGCTAGTACAGGTTATTGGACCCACCCCCGTGTTTGAGGGCATGGTAGCGCTTATCGTCCTCGCTATTCGGGAAGCGGA
ATCGCCGCAAGTCTTTCAAGCTGCGGTTCATCTAGCACATAGCGTGTTCCTGACCAAGGTGACCAACACAAAGAACGAAATATTTCAAACGCAGTTACCG
ACACCTGAAAGTACTGCTGCGTCAACAAACACTGTAGCTCTCGGGCTAATCGACGATATTTCTCGCGCCAATTGGAGCTACGGACTTCGGATTATTCTCG
AGTGGAGTCTCGCAAGCCCTTTTTGCTGGCTGATTACTGCTCAGTGTGGAGGAAAAACTTCACAACGTACCAGTTCATGTAGGCACAACCCTTCGTTTCG
GTCTGCAAATGCACCACCATCGATAGATAGGGGATTCCTCCAGTTCGTTCGCCTGCTGATCGAACAAGATTTAAGTCGAGTCAGCTTCTTTGACGAGCTT
CTTGATCTTGAGCCTGCAGATACTGTGGCTGGGTCGATTATCGCGACAAACCGGTTACGATTGTTCCGCTTAGTGTTGCGAAATGAAATAATTCGCTGTC
AGCTCTCGAAGAATGTGAGCAATGGCATCCAAAGTCTTTGCAGCAGATATGTAGACTCTGCAAGCACAACGGGTGATCTATCTCGTGGGGTTAATAATGA
TGTGTTGCGGCTTGCTACGGAATGCTTGAACGAGATCAACCGGACAAATTCGAGCTCACCCCAAATCAATGCCAGCAAAACCTACACGAAGTCTGTCCGC
AAACACATCGAAGACTTAAATAATTCCCACAGCCATCACACTCATTGCCATCGCCATATTCCACTGTTCATTCAAGATCCCCTCACGAATGCCGAGGCTG
CCACGTTCGCGACACATTTACAGCGATACTTTGTGTCCCAGCCTCGCCCTAATGCGCTTTATCGACATGCATTTGTTCGTGCGAATGAATTAGTTCCGGT
TGTGGATGGAGAGAATTCGGTTGAATCGTTTCGTAAAGGCAACATCACTTTTGAAGGACACGTTATCGCAAGAACGCCATCAAACGAGACTTTTCACGAC
AAAATCCAGCGAAACGCAGCTCCGTTTGTGTTCGACATTGACACTTCGATTCCCAAGAAGCCACCCACGACGCATTCCTCTCAACCAGCAGACAAGCAAC
AAGTTGTGTCTAGTTTTGCTACATTTCGAGGAGTAATCGAAAAGCGAAGTGACCCTCCAAAACGACCAAGTAAAGTTTCTTCAGCCGAAACTGCACAAAT
TACACCGACCGCACCAACTCCAAGAACCACATTCAAGACGACCACTGAGCCATCCGTGAAGATTGAAGAACCTACGACTTCCTCTGCTACCAGAACCCCT
TTCACCAATAGTGCTGATGCAGATATGGCAAAGAGCACAGTTCGGGGTATGAATTCCCCACCAAACAGTACACCCGCGCATCAAATGCTTTCACCGTCCT
CACCGCTTGACAACCATCCTGCGGCAGTTGCTGCTGCTGTTGAACAAGCCAAAGCGAAACCCGACGACAAAAAACAGTTAAACAATTCTAAGCCGCCTGA
CCGAACCAAGAAAGACGCAGGCAAAGGGAAAGCAAAAAGCAAAAACCCTGACAACTGCGTGCTACAATAAGTTTTGTCTCAATAGTAACTATTGTTTTAC
TATGGACGAGAGATTTCCGTTATTCTTTTGACGAAGAGGAAAGTCGTATCGACGCTGATGTTCCGGAGGTAGTTTGCTGACGTAGTGACTAAGTACAAAC
TCCTCGTCTACATCGTTACAAAGAGCCAATACGAGTTGCTTGGCTGCCTCGCGAACAAGGGGATTTTCGTGCTGATCTGCATCACTTAACGTTAAGAAGC
GCAAAATGCGTCGAGGTGCAATGTCAAAACTTGCGCAGCAGTGAAATGACAATAGTAGCGCTGATAATAGCTTCAACAGGGCTAGAAGCTGCTGGTCTGA
AGGCTGGGAGTTTTTGTGCTCAACATGCTTAAGAAGAAGGTGTGTCACGAATGTGCCTCGAGTTCGCGTGGAGCCTGCGATCTATAAAATAACGTCTAGC
TTTAGCTGAAGCAAAACAGTGAGCAAGTGACAGCCACTTACCTTTAACAGAGCGAATGCTGCGGAATTGCGGACTGATGCCTCGCGAGAGTCAAGCCGCT
CCAGCAGACAGTCCACGATTTCTTTCATCTAACCCATGGCAGCAAAAAAAACATTTTTGCGTCAGCTTCAGGCACTTTTGCATGGCCCACTCGCACACTT
ACATCCAATTTCGAAGCAGATGTGTCTTGGAAGTACGCCAACGAAGCCAGCAACGAACGGAGAAATGCACAACCAGCACCAAACACGTCGGTGTTTGTAT
CATCCAATGCTGCGATCAATATGAGAAGGGACTCCTCATCCGACAGCGCATGATGGCTGGTTATCAAAGTTCTTCGATTGAAATGGCGTGTCGGAGCCTC
TGAGGTCTCTGCAAGTTTCCACAAGAGTGCTTCTTTCTCTCGAGGTTGACTGACCTTAAACCTCCTAAGTATATCGTTCTCCTTGGACTTTAGAAGCACT
GCTGATAAATCCTGGTCATCCTTGGTCGACGTAGGTGAAGCTGAAATCCGCTGACAAAGTATACTTTCTTGCTGTTTTCGGCGTCGCTCGAGATCACCGA
AACCTTCCCACAGATCCTCTGTGGTGTAACTTCTGGTATCCGATTGCATTTGAGGTAAGTTCGCCAGACGATCTGGTGCTGCAGCTTCCTCAAATACACT
GGTCAGTTGATTCGCTTCCCTCTCCAACGAAATCCACGGCAGGACCAGTGTATCATCCCCAGCAAATTGGGCTAACTGCTTTCCAATCTGGATGTCAGCA
ATAATTTGCTCGGGGGTCTTCTGCTCCTGCGTATCTTTGATATAGATATCTGCTGCGCGCGGCGACTTGGTTCCGAAAGTCTTTACGGGCTTGGACACAT
TTGTATCGTACGCACTGTAAGCTCGTCGTCGAGGCGACGGTGCATCCATTGTGTTGTTCTTCCGAGGCGACGGTATCATCGGCAACACGACACTTGTCTG
CTGAGGACCTAGCGCTACCACCGACGCTAGTCCAACTTGACTGAACAGGTTGCTTCGTGTTTGGTGGCACGAATGCAACACTAAGCGTAAATGGGTGATC
TTCGGGCACGGTCGGGGAAGCTGGACTTCTTGGAGCTCGCACGCAGCTACGTCTGTGGAATCATTGCTGAGGACGCACACGAAGCCGAGCCTCTCAAATC
GCATACCAGTCTTGCCGTCGTGGATCCCATCGCTCGACGCCGACGACGTGCAAATCTCGACTCGAGTCGCTACTTTAAACGGGTGCGACAGCAGATTCAC
CTGCTCAATCCGCGTTGGCAGGCCGTGGTTGACTCGGAACACAAGCTCCTGGGGAAACTCGCAGAACTTTTCCGACTCCCAAACAGTTAGCTGACCCCCT
CTTGGCCGCGTCACGTTCGTCGCCGGGCAGCGCTCGTCCTCGCTCGAGCAGAAGACGAGCTCCAAGTGAGCGGCAGCCCTCCCCTCGTCGCTCATTTCTG
CCGTCCGCCAAGCCAGCCAGAAATACACGGCAACAAAATGACATACACTCCTTGTTGAAGTTGCATGCTGTATGCCGTTTACAAGGTGGTACTTTGTGTT
TTGTACATAAGTTCCAGAAGGCCTATCTCAATTGTCACATTTCAATACGTGAGCGCGTGCTAAGTCAAAGCAGGAGCAGGAAGAGATGCCGACGCTGAGC
GAGGAGGAGCAGGAGCTGATCCAGAAGGACCGCGAGGCCAACCCTGGCTGCTTCTACTCGACGGCGCTGTCGCAGTCCTGCAGGTCCATCAACGGTGACA
GCAAGTGCGAGATCATCAAGAAGATCTTCCGCCAGTGCCCCAACTCGCGCAAGGAGCTCATCTCGAACCGCAAGGAGATCACGGAGGACGAGCACGGGGG
CGAGGCGGCGGCCGGCGACTTCTTCAACCGCGAGAGGATGGACCCGCGCAAAGGGTGCGTGTGCTGATGGCTATTAGTTGACAATATCGGGGTTGGTCTG
ACCTTGTTCGGTGCATTTGAATCGGTGCATTTGGTGCAGAGGTGACCACGAGTTTGGCTCATTCTTTCAGCAACGGTGCGTGATTTGAGGCAGTTTGGCA
GGTAAATGGGGATGAACAGCATTGGTGTGCTGATGTTCGGGGTGTTGTGAACGCAGAGGTGACGACTTCGAAGCCCAGATGAGTCCATTCGACTTCCTCA
GACAGGAAATGCTGCGTCCTTTTGAAGGTACGAGTTGGGAGGCTTGGGGCTGGTTTATAACAGTTGTAACAATGTTTTAATTTGCTGGTGGTTTGCTGTT
ACAGACTTTTTTGGTGGAAGTATGCTCGGTCGTGGGGATTTCAACCCGTTTGAAGGACTGGAAGGCGAGTTTGAGCGGATGCCAGTGCGCCCACCGTCGC
CGACACCTCATCGACCATCGCGACAAACGCCTTCGAATCCACCGCACTATTCATTTCAGCCGTCTCAGGGCCATGGGTCAAATGGTAGGGAAATTTCGTG
TTGCTGGCAACCTGTTGCGTTTTCTAAAAATTTTTGGTGTCGTCGTGCAGAGGCAGAAGCGAAAGCGCGCGCACAAGGCAAGAGCGACATGTTTGCCGAC
TACTCAGGCCGCGTGGAGGAAGTGTA