Description :
From Genome Similarity Track
Location :
Scaffold_45:158596- 160741
Transcript NameFunction/comments
Phyra_80042Hypothetical protein
Phyra_49306serine/threonine protein kinase

Sequence
2145 bases(100 bases per row)
TCCGAGCTCTTGGGCTCAATTGTTAGGCAAGAGCTCCAATAAACTTGACGCCGTGTCTCCGGCACTACTAGTACGCTACATGTATCGTGAGGCCGCCGCT
TTCACGCAAATAATATCAGTAAGTCCTTGCGGTGCGGACACGCACAGCGACAAACAGTTACAGCTGCGTGACTGCAGTCTGGATTGCCGAGTCACGCGCC
CCACAACGGTACCCTATCTTGTCGGCATAAGCGAGGGCAGGCTGGTCCGGACTTATCTTGCAGGCATGGAAGAGTTATGGTTCTCGACGTGGATAAGTGG
AAACATCAGGTTAGTATATGGGTGCAGCTGGTTCTGCGGCGTGAAACTAAGGTGGGCAGCTTCCCAGGCTGGCAGAGGCGATCGCCCTTCGTCAATTGGG
TAGTCGGTGAAGCGTCGGGCGATCACTTTCCAACTTGGCTCAGACGAGTACAGTACGGCTGGAAGCAACCTGCTTGGGGACAGGAGCAGGATCATCCCGA
GCATGGGCTCAGCTCGCAGGTTGCTGCTAGTCGCAGCTCTGGCGTTCGCCATCGCGGCAGGTAAGCCCCAGTATTTTTCGGCTCAAAATTCGGGAACGTT
TCCAACATTTGTGATCAATTGTTGCAGATACTCGCACGAGTGCGAAGCTGTCAACCCTGACGCTCTCTCCTGACGCCGGGTCCCTCATCACCACGCGTGA
TGACTCAACCGGCACGTCGACAACGACATCGACCGACACTTCCAAAGGGGTCATTGGGAGCGCGGCGTCGGACACCAACAAGGTCACGAAATCACCTGCA
ACCGAGACTCCAGCAACTGAGGCTCCAGTTACCCCAGCGCCCCCGTCCAGTGATTCAGGCACGACTTCGACGTCTGGCAGTGGTGAGCAGGAGACGACCG
AATCCCCGTCAAGTGCCTCCGCAACAGTTAGCCCAGGCTCCGAGTCGGACCGAAGCAGCCCGGAATCTCAATCCGAGACCTCGGCGAACTCGTCGTCGAC
TTCTAAGTCGTCTACCGCTAACGTCGACACGCTCAATGACAGCAACGGGACGATAAGTGCGGGCAACGGCACGTCTAGCATGGGCACGATTCTCCCGGTC
GTCTTTGGAGCGCTCGCTTGCGTCGGTGCCATTGTCATGGCTGTGACGTACAAGAAAAAGCGTGACGCGAACTATGCGGACGAAGACAACCGTCTCAGCT
CCGACTGCGAATACGCTAGCGGTGCAGATTTCACCCCAGACAACCGAGCGCTCAGCCCTGTGCAGGAGGACACTCCACCCGTAGCAGTCAGGGTTCCGGT
GCTGAGTACCCACTCCAGTACTGACTTGTCAGCATCTGCAGCAATCGCCGATTTCACGGGGACCAACTCGTCTGTCTCCTCTTCATCCCCATTCGGCAGT
GCGCACTGCAAAGTGCGCATCAGTTCTCCCGTTCAGAACGGTCACTCGAGTAGCGAGACCAATATGGAGTTCCAGGATACAGCTCCCCGCCACAACAGAG
GCAGCAACGTGGTGTTGACCATCGAAGAGCTCCGCACCGATTCCTCTCATACTGGGCCCCAAGTTCAGATGTAAATAACGCGTTGTCGCTGTTGCCTCTG
GTTGCTTGCCGGATCGCCACACTCTTTTTGTCGTACAGAATGTAGCAACCTTAGCACAATACACCAAACCGTGGAGCACTCCTAGTCCACGCTTGAAACT
ATCCTACTTTCTGATGGCTACACTTTCCTATGATTCTCGTTCTCACACGAAAGTGAATGCTGGATTGAATTCACAATGAAAATCGCGAAACAGCACCGTG
CTGATTTCTATCAGCTCGGCCCACCCGGTCTCTCCTGATCTGCTCTCTTGCCTAACCTTTCTCTCCTTCGATTCGATTCTACCTGCTACTAGTTGATTCA
GCGACCACCGCATGAGCCATCGCTGTGGCCTGTTCGCACGATGTTGCGGTACGAGAACCCGTCGAAGAAGGGGGTGTTCAGCGCCTCCTTCGCTGTCACG
CGATTCTCGGGGTCCAGCACCAGCATGAGCTGCAACAGCTCAAGCAGACCGCTTTGGGCGTCCTCGGGGGAGAGTAAGTCTGCCAGCGAGCGCATCCTCC
GAACGTGGTCTACACTTTCTTCGCCCGATGAACCATCAGGCCAGT