Description :
From Genome Similarity Track
Location :
Scaffold_40:15855- 17122
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012243Similar to gltP: Proton glutamate symport protein (Escherichia coli (strain K12))

Sequence
1267 bases(100 bases per row)
CTCAAGTGTTTGATCACGCCGATGGTGTTCTCAAGCATCGTCGTGTGCATTGGTGAGCTCGTGGAAGCTGGGAAAGCGGCTCGAATCGGGAGCCGCGTGA
TGCTCTACTTTGCCATGTCGTCGCTCGTGTCGTCGACAATCGGGGTGCTCTTTGGTGTGCTCTTCTCCAACCTGTTTGTGTCGCAGCTCAATGTCAAGGT
CACGAGTTTCCCCTTGCCGCAGTTCTCAATCAAGTGCCCAAACGGAAACTATTTGGCATCGTCTCCAGATGCGTACGGGACAATGGCGTTGGCATGCACG
TCCAAGAACGCGACGATGGACCACCAGCTTTGACCGTCAACTCGACCAGCCATCTTTTCATCTTCCGCAAAGAGGGATTCGTCAGCTTGGACGTCACGCA
GCAGATCTTTTCCATCTTCCACGATCTGGTACCTGACAACCTTGTGACGTCGTTCTCAGGGTCCTCGACGCTCAGCGTGATCACATTTGCAATTTTCTTT
GGCGCTGCGATCGTGAAGAGCTTCGATCGACAATATGGCGCCGAGAACTATGCGCTGTTGATGGTGATGCAGATCAGTGTGGTGTCGCGCATGATGGTCA
ACTACGTAATCAAGTTCATCCCCTTGGCGATCGTGTCCATGATCGCCGGGTCGATCACGTCCTATGCATCGTCAATGGAGCTACTCGAGAGCGTGGGCTT
CTTGATCCTTGCTCTGTTCACGGCGCTCACGACGCTCACGATCGGCGTGATGGGGACGGCGCTGTTCGTAACAACGGGACGCAACATCTTCTCGTATCTT
AGACACATTATCCCCGCGCAGCTTTTCATCTTTGGGTGTTCGTCGTCAATCGCGACGCTGCCCATGACGATGCGTTGCGTTGACGAAACGAAGGAAGTCT
CGTACGCGCTGTCGCGGTTCGTGCTGCCACTCGGCGCCTCCGCCAACCTGAATGGCAGCGCAACATACATGACCCTCGTGTGCGTGTTCATGGCCAAGGT
CGGCGGCTACGAGGAGCTACTCACGCCCGTTCGATACATCCTGCTCGCGTTTGTCGGTGCGATCGCGTCCTTTGGCGTTGCGCCCGTACCGCACTCGGGG
CTCGTCATGGCGATCACGGTCTGGCGCACGACATTTGGCATCGACGTGCCGAGCGTGTTTTCGGTGCTTGTGAGCTTCGATTGGATCCTCAACCGCATGC
GCGCAGTCGTCAACATCACAAACGACACGATCCTCGTGCGCATCATCGCTGACCAATGCGACGAGAC