Description :
From Genome Similarity Track
Location :
Scaffold_32:158519- 160762
Transcript NameFunction/comments
g6881.t1POM64093.1 Hypothetical protein PHPALM_20429 [Phytophthora palmivora var. palmivora

Sequence
2243 bases(100 bases per row)
TCTCCTTGAGAGGCTTCCAGTGATTCGGATCCACCCTGCCCTTGGACTCGATGAACTTGACACACAGCTCGAGGTGCGACGTGATGCACTGGTTTGCCAG
TTCTACGAGACTGGTGCGGTCGCCTGACGTGAGGTTGAGCTCCTGGAACGGGTTGACGATGAATCGGCCCTTCATAATGGTCGTATCTACTTGCACGCAG
TCGCCGAAGGAAAGATAGTGGAGGCTACGAAGCAAGTGAAGAAGTGACCCTCAAGGCATGTTGTGCCCTTAAGGGGAGAGGTGGGGAGAGTTCTCAAGCC
TCACGCACCCGCTTTTTACAGTAGCCGATCAGCTCGATAGGCGTTTGCCATATGAGATCAACACCAAAAGTCCTTGTTGTATCGGGTAAGACTCCGTGAC
ACATTAGCGACTGATTTGCTCGACTCTCGAAACCTCAAAATCCTAGGAACGGCGCTGATGCGTGGATTCCCGTATGGTGAGAACTCTATCCGCACAACAG
AACATGCTGCAACAAACGGTCAGAATGTGTCGCGATCACTGCTTGCACACCACAGCTCCAGCAAATTTGGGTGGGGCTCGCCAGCACCTTCAAATCAAGT
GTATTGATCATGATGTTCACTTCAACATGCAGACGAGCTTCCTACTTATCAAGCGACGTTGGTGACAGTATGAAGAGCATCAAGAGTTATCAATATATGG
ACGTGTGCATTAGATTATGGAGCAGCGAGTTCGCCCTTACTGTTCGCAGACGATGACTGTGAATGTGTTGAGCTGCCGACGTCGATACTCCAGAGCAGAG
CATCCTGTTCTGGCAGTGAGTCCGAGTCAGAATCTCGTACCGAGTGCGCGGCAACAAGCGTTGCGCTGGTATCTGACGCCGAGCGGATGCAACGTACGCA
GAAGGTCATCTTCTCCGACGTCACGCCGGGCTTGCACTGCGAGATCTTCAGCATCTTTTGAGGAACGCGACAACTCGAGCACACGCGCGCACAACACACG
CAGCAGATCTTGTGGATACCTCCAGGCGGGGCTGGCTTCACTGTGCGTTTACACAACGCACACTGCTTACAGCACGCTTCAGTCTTCAGTGGAGGGGTAG
CATGTTTGACAAGGTACGCCAGCTTGTACATCTTGGCACACTCGAGGTTCTTGGGGATGGACATGACGATCTCCGTGACGGTTGTCACGACAAGCGACTC
TGGCGCCTCGCCCATTGCACACACAAATCCACGCAGGAAAACATCCACCACGCGCTCGGAGCGTTGGCGGTACAGATAACAATACGACAATTTGGCACGC
ACGATGTTGTACTCGCTCAGCTCTCGGACGTCCGGGAGGTCGATCGAGTGCTTGAGATGGTACCCAAGCGGTTGTTTCCGACCGTCCGAGTCCGTGATAG
TAGTGAACCCCGTCGTCTCGAGGTACACGAGGTCGCGCACTCGCATCACTGCACCGACGAGGAACGGGTGCGCTTTGACCGCCCATTTGATAGACACCTC
GCGGAACGGCTGCGAAGGCGTGGCCTTCACGAGTTGACCCAGTACAGCCCAATCGGCGTAGCCGTCTTCGACGACAGCAGTCTTGAGCTGCATACTACGA
CCTGTGGGCGTTCGGAGACCCAGCAGACAGTCCTCGACGGTACCTTCGAGACTTCCGACCGCGAGCATGAGAGGGACCACTTGATCGCCCCGTTGGGGGT
CACGCAGCCTCGATGCACTTTGCCGCTCCGCCGCCGCGGGCCCGTATTGCTTGTAGAGCGTGAACCGCTCGTGCTGCTTGAGCTTCTTCCATTCGCTCGC
ATTGACCTGTCCATGGCATGTCGTCAAGAAATCGTGATAGTAGTCGCGCGTCTCCTCCACCACGCTCGACGCGTAGTCCTCGAGGGCATCCGCCTCGTCC
GGAGGGAGATCGATAGAGGGGAAGATGTTGCGGGGTAATGGGAGCTTCATGATCTGCTGCTGTGGTGGTTGCAACGCAAAGTCGCGAATGACCGAGCGCT
AACGTGCTTCGGGTTCTTGCTCACGGACGGGACGCTCGGTCGCTGATGGCCTGCGTGCTCTTTGCGCTTCAGATGAAGAGACCGCCGCGCTGCGAGGGCT
TTCAACAGACGAGGCCTGATCGTGAGCGAGGCTTTGGAAAAGAGCCAAGAGAGTGCAATGCAGTCGTGGCGTTAGTAGAACTGTCTAAGGCGCGCGTCGT
GGCCGATGAAGACGGCGGAGGCTTCGACGAATGTTGGCCATGG