Description :
From Genome Similarity Track
Location :
Scaffold_32:158512- 161890
Sequence
3378 bases(100 bases per row)
TGAATCAGCAAGTCAAGTTGGCCCTCATGAGAGTTCAAGTGTCGGATGCTGAAAAGTGTCTGACATTTGCGGATCTGCTAGCGGGACCGGCCAGAAACTG
GTATCGGTAGCTGGGCAGATCCACTAGGAACAATTGACCATATTTGCTTCGTGGTTTCTAAACCCAGTACTGTGGATTGGGGGTGTCGGTGGCACGACAA
TACTACCACGCTCGCTGCAGATCGGATGAATCCCCGCTGGAATACCTGCATCGACTAAATGTGGCTGGTCTGCGGGCCAAGTTGAAGATCAAGGATGCGG
GATCCAAGGTACTACGGGAACACGTGGATCATTTCATCGAGACGCTGGGAGATGCGGATCTGGTCGACAGGCTGACCCTGTTACGTCTTCCAGACGCGGA
TGAGCTTGAAGAAGTGATTAGGGCTGTGGAGCGCGTGAAACACCGCCAAAAGAAGGCGGCGAACAGATCCGGCAAGTATCGCCAAAAAGCTCCGACACCC
ACGGCCCCAGCTCCACGTGTCCACCAAGTCACAGCGCCCGACTCAGGAACTGAATCGGGATCTGATGGCTCGGACTCCGATCCAAAGGATTAACGCAGAG
TATGTCTCACTGCGCCCAACGATCGTACGGCAAAGACTGGAGAAAACTCTCGCACTAGTGATACCGTCCCCGGGGACCGTGGGATGTACAGATCCCGAGA
TCTCATGGACGGGACAGGACCAATCAGGTGCTCGCAGTGTAGATCCCGGAAGCACACAGAAGCTGGATGTTGGAAACATCTGGTTTGGGAGAAGTGTGTC
AAGAAGGGTCATCCCGGGGATCACTGCTTCTACGTGTGTCGCGTTTGTGGCGAGATCCACGACGCCGGTAAGTGCCCGATGGAAGAGTTCTACAGCCAGA
TCCGCCAATGGTTTGATCCAGCCAAGCACAGAGTTATGTTGCCAGAAGTGGCAGAGAAGATGTTACACTAGGACGCTCGCCAGGTTTGAATCCGGTACGA
GCCGAGCGGTCTAGCTACCGCATTTTTGCATTTGTGAGCAAGACGTCGCTAGATCCAGGTAGCAGGCTCCTAGTTCCAGTCGATAATACACGTGATCGAC
ATGAAGTGTTAGTTGCCAAGGTCTCTAGCTTACGCCGCGTGGACGAACTGGCCTAATCCGACGGTTTTTTTAACCTTGGATCTACAAAGGGGAGAAGCAC
GCGGTATTGGAAGAACCAGCGACATGGCCAATGGTTTGAGTCCAACAAGTTCGATATTTGGGTCGGAGTTCTCGCTGGCCAAGACGCTATTTTTGGAATG
ATTTTCCTGGTACTAGTCGAGGTAAGGTTGGATCTGGCAGATGGGATGTTGTGCTTCCCAGATGAGATGCGGATCCATCTCAGTGAACGTTGACCGTTGT
ACGGGGCGAAGACGATATTCATTAGGGCAGTCAAAACGGCCTGGATTGAGCCGGGGAAACCTGGTAATTGCCGGATCGAATGAAATGGGTGGAATATGAG
AAGCTGTGGGTCACTCGAGGCGAGAAGTGGGTGCATACAGTTATCCAAGGACCTGGTCGATCGCAGTACCGCCACTTTTACGAATGTCAGTGACAAGAGG
TCATTACTAGATCACTATGAGGGAATTGGACGATGGCTGGCAAAGGATGGTATCCCTAGGCGACCTAGGGTTGCGTCAGTTGGATCTCGTCGTTATAGAG
AACGCCAGAATCCAGCGTATGAAGGAGCTACCGAGACTGAAACCTCGGGAAGGTAGAGGCTTCGACGGAGCCTACCGGCCCCTTGGTGGACCGACCTTCA
TATCCAACCCTGCGGAAAAGCCTACAAAGAGGTCGTCGGACTGGGATCCAAGTGGTGGAGGCTGGATCTGAGACAGCAGGAGATACCCGGAGCCAGTCAC
CCAGGTAACCAGGGGTCGATGGATGATGGATCTCAGGTGATTGAAGCCGGCCCGTTGGATCCCACGAATCCGCACCTAGATCCAAACTCTCGATTGAACA
GAATGCCTGTATCACTCTTGAGAGTGTCGGCACTAGTTAAACTGGAGCCGTCATACGTAAGCACACCAGAAGACCAAGTCGGTCCAGTGGGCAATTTCCC
AGGTACCAGAATATTCGATTGAGTAAAAGCAGAAAAGCCAACTGAAGAAGGGAAATCGTGGTGTCTGGATCCAGTGGTGGGTCCGACAAAGACTGAGGAT
GAACAGGTATGTTACCATGAAGGTGGGGGTCTGCACGCCGAAGAGCTTGGGGAAGATATGGCGGTAATCCCAGAGGTGTCACTGACCACAGAGGAAGTCA
CGATTGACGATGTCCAGGTGGATCCGGGAGCGAACGAACCCGCGGAAGTGGGCCGAATGCGTCAGAAAATATGGGAAACCGACATCTGCTGATTGGCAAA
GGTACTGCATTACCGCCAGCCGCACGTGGAGTCAAATGTGATATCGATGTCGGCGACGCGAAGACGATTGCTCAAATGGTACGCAAGGTGGCACCCCAGT
TCCTTGAAAAGCTATCAGATCTGATTTAAGGTCTGTTGCGAGCCAAGATCATCCGTTTCTCAACCTCCCCGTGGGCGTCTCCTGTGGTGATCATTATTAA
GAAGAACGGGGTGGATATACACGTCTGTGTATTAATTACCAGGTGGTTAACGGTCTGACCAGACTGATGGTGTATCCGATGCCTCTAATTAATGAGCTAT
TGAAGGATTTGGATAAAGTACTCTGGTACTGCTCTTTAGACATGACGAGTGGATTTTGGGTGGTAATTATAACGGATCGACCTCATTCAATATCCGCATT
TATTACACCATTTGGACTGTTCGAATGGAACCGGATGCCGTTTGGATTGTAGAATGCACCCCAGATCTATCAATGTTTGATTGATAATGCCCTCTACGGT
TTACTCGAATCCCGGAACCCAAAGGGGGTGGGTCCGGAGAAGGTAAAGCGGAAGTAGATCCATTCGAAGCAGGCGAGCCAGGCGATCTGGGGACACCATC
CGTGTTAGGGCGAGAGTTTAATATCGACGACATTCTAATCTCGGCGGAATCGTGGGATCAGCTACGCGAGAGCGTAAAATCCCTACTGGAGGCGTGCAAT
AAGTGGAAACTCTCTATCAGCGTGGTGAAGAGTTATTGGGGAATGCGAAAGGTGAATTATTTGGGTAATCGGTGTTTCCAGAGAGGGATTGGAGGCGAAT
CCAAAAGATCTGTCTTAATTGGCAGATTTATCTTTCCGCATTCGCTACGGGTGATGCATCCGTCTTGGGCAGTTTGAATTACTACAGTCGGTTCATTCAG
GATTATGCACTTTTCGCCGCAGCCTTCTATGAATTAGGGAGGTGGACTTTGCTGCAATTGCTACTTCGGCTGTCCGGA