Description :
From Genome Similarity Track
Location :
Scaffold_515:15845- 17445
Transcript NameFunction/comments
Phymu_g10505myosin-like protein

Sequence
1600 bases(100 bases per row)
cgtcctcccCGCAAAAGTAGCTATGGCCCGGAGGATTGCAAAGCCCGCGGGCAGGCGGTTGGGTTTCCCCTAGAAGGCGCCCTCTGTCCGCGCTCTCTCC
TCTCCAGAGAAAAAATTCTCCCCTGCGCAAACCGATCACCTGGTCTGCCCCGTCTGCACCACACTTGTAGTTTGTATGGCGCTCAGAAGATGGGCGTGCT
TGTTTCTGCCCCTCCCGAGGAATTCGCAAAACACGTCACAAATACTTACTAAAAGACGTCAATGACACACCAAAAATGAACAAAACAAGATGAAAATAGC
TCTCGGCTAGGTGCGAAGTTGTCACTTCAAGGAACCAGGATCGTGGCGCATCACGCAAGCCATATCTCCTTTCGCGGGGTTTGCGTGGACAACACAAAAG
AAGCCATGTGAGAGATCCGCCATGTAAAACTGTCATGAAACCGACAATCGCACCGATGGACGTGTCGCCGCCGCGCTGACGTCGTCTCCAAGGATAAGCT
TTGGCATGTATTTCAAGGAAAATATCGTTGCTTTCTTCCTGCACCTGAGCGATGGCCACTTGAAGTTGTTTGCAACTCGAAGGGCAGCGGCGGGGAGACG
CACAGCCCCCTCCCTACCCCGTATGAATCAGGGCCGTGCTGGCTGCCGCGTCCGCCGGACGGTCCGGGCTGCTGACTGAGTCagctggctgcagcagctc
gtaccTCCTTGTTGGCCACGAGTATATTCGTCAGATAGGCCAAAGGCCCACAACTTAGGCCACAAAGCGCTTGCAGTGCTGCGGCGCGTTGGCATGCTCC
GCAAAAGGCAACCTGCACATGTACTTGCATCTTTGGAGAGCGTCTCCCGTGCCAAAGACATGACCGAGGCAATTTTCCCGGGGGACTATTGTCACACCGG
CGTGATGACGACGGGCTAAAGCTCGCGGCTGAGTCAGCTGTGCCCCTTGGCTAGCTGTGAGTCGGTGAGCTTTACGATTGAAGACGCCTTCCTTGGTTCA
GTACACCGCTAAAAGATCGCCGTAAAGCGCACAgctgcatgagctgctgccgggAAAGGCTTTGCCGGCAGCGAGCGCGCCATCTCGGCCACGATGACCG
TGGCCTCGAGTGTCGGAACATTCTCGAACAAACCGCGCATAGCACGGGGCTCGGCCTGCATCATGCGGCTGCGCGAATGAAGGCACCGAGCGTATCCATT
GTTCCTGTGCAGAATCCGCGCGCAAATGGCTACCTCGGAGGCAACAGAGAGCAGCCACCGCAGCGGTGGTCGACACCTTCGCTCCGAgtcttggagctgt
tcatGCAGGAAACCTTGCAGTGCCGAGCTAGCTTCCAGCGGGAAGCAGCATTGCAGGGTGACTGCCGTCAGTTCGTTTCGCAGCATGCGTGAGCCGAGGC
CGTTTCGTATTAATCGCAGTGTAGTATGGCAGAGATCGATTTCTCACACCAGCTGGAGCTGAACACTTGAAGCGGGCGGCACCATGTTATGaaccaacag
ctccaagGTGGAGTCCAGCACCTCCCCATTTGCCCCTCACGCCCCAAGCTGCAACGCGGGACTCGGAATGACTGGCGCTCGAAGAGGCACACCGACACGA