Description :
From Genome Similarity Track
Location :
Scaffold_161:15839- 18568
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_161-abinit-gene-0.32Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_161-fgenesh-gene-0.8Carbohydrate-binding protein

Sequence
2729 bases(100 bases per row)
CTTTGGTGCTCAATTCCATGGAAATCGAGATCAAGCAAGAGCTCAAGATCACAGTGCAGGGCAGTTGGTTCAGCGCCGTGTACAATCTACTCGCGTCCGT
GTTTGCGGAACTCATTCGCGAGTACCTGGCCAAGACCATGGAGAGCAAACTGCTCGGTCACATGATCAAGCTCCTGAAGACGCTGAACGACCAGATGGAC
GAGTACTGGCCGCTGATCTTCCAGCTCTTGGACATCCGCGTTGACGATTTGCCGTCGGCGAGTCCATGGCGCGGCGCGAAAGAAGTCGACATTCAACCAA
ACCAGGTCGAGTGCGCGTTCGAGGACCGCTCAATGGTGCCGTTCACATTTGCCAAGAGCGTGCTCCACAAGCACGTTGTCATCACGAGTCGCATCGCCGA
TGTTAGTGATACGAATGCCGCGGACCTTATGCGCGTGCCGGTCGGCGCGAGTGTGCTCGCTGTGAACGGACTAGCGTGCAACAAACTGAATTTGGATGAG
TTCAAAGCCATTCTCGAGAAGCTCGCAACTCCGTTTACGATGCGGTTCTCGTTGGCAGTAGAAGACATCGGAATGAATCGACTGCAGCGCATCGTGCCGC
GGCAACAGTCTGTGAGTGTGACGTTCAAGCAAGACGGTCCGTTTGGCTTCCGTTTGCGAAGTCGGCCACTCTCGCCATTTGGATCGATTGTCGTCGGCTT
TACGGAACCAAGAGCGGATGGCAAGAAAAGTGCCGCGGAGCTTAGCGGCAAGATCCAGGCTGGCCAGCTGCTCCTCAAGGTCAACGACATTGATCTGCGT
TTCAAGTCGCTGCAGGAGACGCTGCAGATCCTCAAAGAGACGACGCGACGCCCCGCAACGCTGCATTTTGCGCCGAGTCCAGATGGCATCATTAAGCTGC
GTGACTGGCCACCGATGATCGAGATGGAGCTATCGGATGAAGAAGCCGCCGACGGACGCAACTACTGCGTGGTGTCAGCGTTTGCACGCGTGCCATCGTT
TGCGCAGAAGAGTCATCTCGTCCAGAAGGGCGACGTGCTCCTGCGCGTGAACGATGTGTCGATGCTCACGCCCATTTACGAGCAGAACAACTTTGCGACG
ATCATGGAGACACTGAAGCAGATCTCGGACGCCAAGCAGCCGATGCATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGTCCGAACAATA
TACAGACCTGCGAAGACAAATATGGGAGGCTATTAGTTTGTCCGCTAGTAGCACCAGTGCTGACAGCGTTTCACAGACGGGGACTGCTGCTCCGACATCC
AAAGAGACTGGCGACGATGCCAACGAAGAGAGTAGCAAGAGCGTACGTGTGGAAGATGCTGTCGTCATGGCCTTCCTGGCCACGATCACGCCGAAAGAGA
TTGTGTTCCCGAAAGCGCCTCTGGGCATCCTCTTTGGCAACCTGAACGACGAAGCCGTGTACATTCGCCAGTTCATCTCGAGCACGGGCGCCGCCGAGAA
ATCGGGACTCATCCACGTCGGTCAGGCGGTGCTACAAGTCTGTGGGAAGACCGTCCCCGCGGACGCCACCCCTGCTGTGATCGAGCAAATGATCGCAGAC
GTCGCAACGCGCACCAAGCCGCCGTCGTCGTACACACTCACAGTGCGGGACTTGGATCTAGAGCGCGAGCTCATGAAGTAGATAGACTCTTACAGCACAG
ACAGGTACGAGACCAACACGCACGTACACACACAATTGCTTGCCTTGACTCTTTACGCATAAATGAATTGTCTTAGTCGTCACAGCATCGCACATAACTC
TCTTTTTTCATCTAGGTCTCAAAGGATCTATGGACAGTAGACGAGTTCAAAGTGCTCGTCACTGGGACAGCTATACACCTTATCAGCGTCGTCAGTGGGG
AAATGATACGCTTGCGGACAGCCATCGTGCTGGCACAGGACGCTTTCACATCGGAAGCCACGCGCGTCTGGGAACTTTGTTGGCGCAATCAGCAACGGGA
TATTGAATCCCGTGCGCGTCGTGATCTTGCGGCACTCCTCGAAACTCTTGCAGAAGCCCGAACCAGGTGGAATGATGCTGATATCGTACCAGACCTTGTC
TGATTCACCAGGTTTGCGCGCACTTGGAGCAGTATACGCGAACTCTGCGACTGCATCCACAGACAAGCAGTTAGTGGTTACATGTAATGGACACTGAGAT
AAGCGAATCACGTACGCGTTGCCTGTGGGTCGATGCCGTTGCGATACATGGTCACATCGGGAATCGTGCGGTTGCAGCCAGTCACGGGTGCATTTGTGGA
TCCCGGTGCGAGTTCACACAAGCCAATGTTGTCGAAAACCTGGATCGTATGCGGACATTGATTCTTGAACGTCACGGTCGCGCCATCTACAGCCGTCGTG
CTCAACGCGACAGTGACGGCGNNNNNNNNNNNNNNNNNNNNNNNNNAGAACAAGCGCCACCATTGAAGCTGCGAACGTAGATGACGAAGCCGTTGTGAAA
TCGCTTGCCGATGTCAGATTCGGAAGTGAAGCGGGGCTAGACGAGAGAAAAGACAATGCATTCGAAGCCAAAATATTGTCTTTTTTCATTTTTTTCTTAG
TTGGGAGGCAAGAGCAGCAATAGCCATCGATCCGTTGACCGCCTTTCTCAACAAATCAGGCAACAGGACCTGTAGACGGCAGCATGGCTACATTTTTCTG
CGTGTATGCGTCCATATCTATGAATCGGT